Tweets at Acharnes around 30km

It searches the Pokestop Tweets of Twitter around Acharnes 30km.


Search Results

ΠιτσιΦρικη pitsifree

Μου 'χεις κάνει το βίο αβίωτο

RT @vlaxakolonakiou: Φυσικά και δεν είναι όλοι οι άντρες το ίδιο!
Άλλος θα σε απογοητεύσει την πρώτη βδομάδα,άλλος σε ένα μήνα,άλλος σε δυο…

2018-08-16 19:50

seaweed brain wjscaliao

SHS | Animo #5💚| Sumusuka pero hindi sumusuko😌
  
                              

@iheartshao Ayiiee imong mama na siya oh

2018-08-16 19:50

Φωτεινη Καλ keep_kal

οτι μπορεις να κανεις η ονειρευεσαι πως μπορεις, ξεκινα το. *Virgo.nice on the outside,naughty on the inside*

RT @MOTOSPORTINK: -Πως θα γυρισεις από τις διακοπές ;
-Άφραγκη

2018-08-16 19:50

Maria Sotiropoulou mariasotir

MD, Author president of the Greek Affiliate of IPPNW, representative of ICAN in Greece

2018-08-16 19:50

chrysib11 xbilli11

RT @parodynews: Mαροκινοί,Αλγερινοί και Πακιστανοί έχουν προσαχθεί για το έγκλημα του νεαρού 25χρονου φοιτητή στου Φιλοπάππου. ΔΥΟ χρόνια τ…

2018-08-16 19:50

DJ Vanilla vanillatweets

Hip-Hop DJ since the golden 90s.
Photographer.

2018-08-16 19:50

K K kkos888

RT @YiannisLoverdos: Μέσα στην αφέλεια του, ο μπάρμπα Φώτης Κουβέλης ομολογεί ότι η ελληνική κυβέρνηση δεν είχε ιδέα για την απελευθέρωση τ…

2018-08-16 19:50

Andreas Vassiliou 1andvas1

CRIMINAL DEFENCE LAWYER - ΔΙΚΗΓΟΡΟΣ ΠΟΙΝΙΚΟΛΟΓΟΣ ΑΝΔΡΕΑΣ ΒΑΣΙΛΕΙΟΥ - 5 Roma Street, Kolonaki, Athens, Greece Tel. +30-210-3621349 & + 30-215-5109904

ΑΑΔΕ: Εκκαθάριση ΕΝ.Φ.Ι.Α. 2018 - LawNet

2018-08-16 19:50

FL News Flnewsgr

Ολα όσα θέλετε να ξέρετε για τις ομάδες της Β' Εθνικής. Παρασκήνια, συνεντεύξεις, ρεπορτάζ, θέματα, στατιστικά, βίντεο, ατζέντα, ιστορία...

Κοντά στον αντί-Μακρή

2018-08-16 19:50

To Arma me tous agious bmwdakiasss

Ιδιότροπος😀 Συνεταιρος στην νυστα @miamia28m μην μας ξυπνατε.Στη ζωη μου έλεγα οτι αισθανόμουν εκανα οτι ενιωθα και τα @@@@@ μου τα πήρα ειχα πρόγραμμα παιδιά.

@EleniMitakidou Τυχερη που έχεις την μαμά σου...Μην είναι όλα αυτά που είπες συν η ηλικία συν ότι ξυπνάω μίσος πάνω…

2018-08-16 19:50

σαρδέλααα MariaStath751

If it's about music and wine, I'm in!

RT @exo_nevra: Έναν τρελό να βρούμε να συνεννοηθούμε γιατί με τους νορμάλ δεν βγάζουμε άκρη

2018-08-16 19:50

απαγορευμένος καρπός sex_PYR39

μια θάλασσα γεμάτη πεταμένα καλοκαίρια...

RT @38_shopgirl: Είναι εδώ κάτι Βέλγοι έχουν ξεπατωθει στη χωριάτικη σαλάτα, βουτάνε το ψωμί στο λάδι, πρέπει να έχουν φάει 2 κιλά. Olive o…

2018-08-16 19:50

Andrianna GerondiKethesy

2018-08-16 19:50

Dimitris Sta'Isa Staisd

Το κορμί στο avatar είναι τσόντα στο πρόσωπό μου.Δεν το βάζω κάτω, όλα θα γίνουν καλύτερα, το πιστεύω! Αντιμετωπίζω τη ζωη θετικά, με χιούμορ και ερωτισμό:-)xxx

RT @vlaxakolonakiou: Εσείς που καυχιέστε στο τουιτερ για το ποσο γαμάτοι είστε,κανα φίλο έχετε?

2018-08-16 19:50

ElenasDiaryBlog ElenasDiaryBlog

"Το μόνο που επιθυμεί η Μέγκαν είναι ο πατέρας της να σταματήσει επιτέλους να μιλά στον Τύπο με τόση αδιακρισία".…

2018-08-16 19:50

Maria Blagoeva 294051f6a9c842d

RT @YiannisLoverdos: Η Αθήνα στο έλεος της εγκληματικότητας και της λαθρομετανάστευσης. Ως πού θα πάει αυτή η κατάσταση, σύντροφε Σκουρλέτη…

2018-08-16 19:50

naftemporiki.gr naftemporikigr

Ρεπορτάζ, multimedia, ειδήσεις από την Ελλάδα & τον κόσμο.

Τα διεθνή μέσα ενημέρωσης για την απελευθέρωση των δύο Ελλήνων στρατιωτικών

2018-08-16 19:50

Julie Wark JulieWark

Traductora. Autora del libro Manifiesto de derechos humanos y de Against Charity (con Daniel Raventós), 2018

RT @yanisvaroufakis: Greece's desertification, today acknowledged even by the FT ( can only be reversed through th…

2018-08-16 19:50

κουρκουμπινι oink93oink

πολ μηχ πουλ μουρ

RT @beatBukowski: 2 χρονια στο ντιρί και αυτόματα αποκτάς τουπέ τριών μεταδιδακτορκών

2018-08-16 19:50

matrix24GR matrix24gr

Αποκλειστικές ειδήσεις, Αναλύσεις, Παραπολιτικά. Σπάμε τον κώδικα της ενημέρωσης.

Πώς σχολιάζει ο διεθνής Τύπος την απελευθέρωση των Ελλήνων στρατιωτικών

2018-08-16 19:50

Φοίβος Λοξίας foivosloxias

militant antitheist, politically incorrect, uniamateur, strongly anti-VEGAN

RT @PattiVassilopou: Today (16th August, 2018) is... Rum Day! #RumDay via @daysoftheyear

2018-08-16 19:50

Chris Koseloglou chriskose

Journalist ALPHA TV /I.R./ News - Host of #ALPHA_Newsroom at @Alpha989

RT @a_loverdos: 📌Καλημέρα!
Στις 9:30 συνέντευξη στο ραδιόφωνο του Alpha989

2018-08-16 19:50

Van Kir vankir9

RT @MOTOSPORTINK: -Πόσο χρονών είσαι ;
-Τέτοια εποχή διάλεγα ποδιά από το Μινιόν

2018-08-16 19:50

BinDNA bindna

DNA Sequence Generator

CGGCTCTGAAATAAAACTATGGCGTCGTGAGGACGATCGCTACCGCAGGTTAATTCCGGACCCACACATTGAGTCCGTGCATAGCTAAAAGAGCCACTAAATTACTGCGTGAATT…

2018-08-16 19:50

No More Jazzz NoMoreJazzz

#music #concert #audio #video #production #postproduction

RT @AndreasNtotsias: Freddie Hubbard !!!!!
The Black Angel 1970 !!!!!
/> />

2018-08-16 19:50

Jeanne K. Cosmos jkcosmos

Former Assistant DA & Defense Atty. J.D. M.F.A. Parent, Writer, Faculty, ESL Educator, Activist

RT @yanisvaroufakis: The desertification caused by the permanent debt bondage imposed upon Greece by the troika is now acknowledged with a…

2018-08-16 19:50

thalis む th4lis

θέλω ντόπερμαν αλλά έχω τσόου τσόου

RT @savoidakis: @th4lis Or how it didn’t; this charming myth has been debunked by German historian Heinz Richter:

2018-08-16 19:50

Pauline Dewberry Lazypaws

Passionate about animal welfare; love cats; hate cruelty to animals. Writing 3 books.

RT @Nicholas_Rossis: @AgentBertram

2018-08-16 19:50

Athina Lau Vanillaburp

MSc in Health Psychology. 3D Model & Digital Artist for the Minecraft Marketplace. YouTube: | MC Portfolio:

Heya! I did something in Hearthstone during my stream so here is a video about it (´∀`)
/>
T…

2018-08-16 19:50

Van Kir vankir9

RT @BlackOlgitsa: Ο άλλος στο δρόμο κράταγε στο χέρι ένα αλάτι ένα χαρπικ για τη λεκάνη, ένα αβα για τα πιάτα και ένα σφουγγάρι.Μια σακούλα…

2018-08-16 19:50

Athina 9.84 radio A984Official

Tα τελευταία νέα από τον Αθήνα 9.84

Μετά από δύο χρόνια ο Στράτος Σβάρνας επέστρεψε και επίσημα στην ΑΕΚ, όπως ανακοίνωσε η ΠΑΕ.

2018-08-16 19:50

No More Jazzz NoMoreJazzz

#music #concert #audio #video #production #postproduction

RT @AndreasNtotsias: Hank & Elvin Jones !!!!!

2018-08-16 19:50

Το Παρασκήνιο paraskhnio

Εβδομαδιαία Πολιτική Εφημερίδα, Ειδήσεις και ρεπορτάζ για την Ελλάδα, αναλύσεις, εκτιμήσεις για την πολιτική, οικονομική και κοινωνική ζωή της χώρας.

Χαροπαλεύει 5χρονη μετά από ανακοπή! -

2018-08-16 19:50

No More Jazzz NoMoreJazzz

#music #concert #audio #video #production #postproduction

RT @AndreasNtotsias: Dizzy Gillespie !!!!
Never on Sunday.1963 !!!!

2018-08-16 19:50

SEXSYMBOL ΣΤΑΡΟΥΜΠΑ MERKEL_7

ΤΟΥΣ ΣΙΧΑΙΝΟΜΑΙ ΟΛΟΥΣ ΔΕΝ ΚΑΝΩ ΔΙΑΚΡΙΣΕΙΣ. ΕΙΜΑΙ Η ΘΕΑ ΤΗΣ ΑΝΤΙΔΡΑΣΗΣ ΑΝΤΕ ΓΑΜΗΘΕΙΤΕ

RT @killbill_kovou: -Άκουσον μεν, πάταξον δε.
-Οκ μεν.

2018-08-16 19:50

pistepseto pistepseto

😋

40 φωτογραφίες με απίστευτες μεταμορφώσεις ανθρώπων μέσα σε 6 χρόνια

2018-08-16 19:50

Καμμένο Τσιπάκι kammenotsipaki

Θες και bio? Δεν υπάρχει...Κάηκε... I am for the festivals...Μουσικορομαντικοκαφρικό ακκάου...

Ω ωωωω καλά κουράγια.....

2018-08-16 19:50

gazzetta.gr gazzetta_gr

Η καλύτερη δημοσιογραφική ομάδα του αθλητικού internet παίζει μπάλα εδώ!

Αν έχετε αποφασίσει να γυρίσετε όλο τον κόσμο, αυτά τα σημείο αφήστε τα απ' έξω!

2018-08-16 19:50

newpost.gr newpostgr

Πολιτική, επικαιρότητα, οικονομία, κοινωνία, κόσμος: Eιδήσεις που αξίζει να γνωρίζει κανείς!

Δίχρονο αγοράκι καπνίζει 40 τσιγάρα την ημέρα

2018-08-16 19:50

EL T eltnutter

I love naps..it's exhausting being a c@nt

RT @killbill_kovou: -Άκουσον μεν, πάταξον δε.
-Οκ μεν.

2018-08-16 19:50

SPORT 24 Radio 103,3 Sport24Radio

Ο SPORT 24 Radio 103,3 αποτελεί την επέκταση του μεγαλύτερου αθλητικού brand της Ελλάδας, του @SPORT24. 24ωρο πρόγραμμα, & αναμεταδόσεις από όλα τα γήπεδα.

ΤΩΡΑ στον «αέρα» ο @Tsak_attaq με ΟΛΟ το ρεπορτάζ του @PAOK_FC

2018-08-16 19:50

seaweed brain wjscaliao

SHS | Animo #5💚| Sumusuka pero hindi sumusuko😌
  
                              

@leyaannnn Share na yan

2018-08-16 19:50

No More Jazzz NoMoreJazzz

#music #concert #audio #video #production #postproduction

RT @AndreasNtotsias: Oscar Peterson !!!!!

2018-08-16 19:50

Chris Koseloglou chriskose

Journalist ALPHA TV /I.R./ News - Host of #ALPHA_Newsroom at @Alpha989

RT @a_loverdos: Ο ορισμός του αλλοπρόσαλλου στην Εξωτερική Πολιτική.
Έλεγαν οτι θα δανειστούν χρήματα από Ρωσία και Κίνα και κατέληξαν να υ…

2018-08-16 19:50

ΕΜΠΑ emthpa

ΧΕΣΜΕΝΤΕΝ

@tribunegr ola ayta alla kai ta lhgmena pou pernei h kybernhsh ayta kai an bohthisan pssss leme

2018-08-16 19:49

No More Jazzz NoMoreJazzz

#music #concert #audio #video #production #postproduction

RT @AndreasNtotsias: Red Garland !!!!
/>
/>

2018-08-16 19:49

Kivellie Papado kivellie

in love... crazy... on a diet... blonde... and needs a vacation

You can anticipate that something meaningful is just around th... More for Cancer

2018-08-16 19:49

EurohoopsGR eurohoopsGR

Basketball Website

Νταρουσάφακα: Υπογράφει ο Τζον Ντίμπλερ | Eurohoops

2018-08-16 19:49

SIRIUS syrios123

RT @gioxar1: Τι λες ρε μάγκα σοβαρά? Γράφεις καλά, σ αρτάρω κάθε μέρα κι εσύ ούτε ένα για δείγμα? Ούτε ένα από ευγένεια? Τίποτα δεν σ αρέσε…

2018-08-16 19:49

Kouti Pandoras Kouti_Pandoras

Κατρούγκαλος: Καθοριστική η συνάντηση Τσίπρα-Ερντογάν στην απελευθέρωση των δύο στρατιωτικών

2018-08-16 19:49

Μαρια💕 DWvhKA0CJ7U3l8p

RT @elekara2410: Καλημέρες καλημέρες 🐓☕🌞☀️🌅 με έναν ήλιο φωτεινό και⛵⚓ λαμπερό! Ακούω ότι βρέχει☔🌦️ αλλού.. Εύχομαι να έχετε μια🌈⛱️ όμορφη…

2018-08-16 19:49

Akatalogistos Akatalogistos

RT @theogiannaros1: Τώρα θα βγουν και άλλα στη φόρα, dear αναπληρωτά μου!
Τα έγγραφα δεν είναι δα και επτασφράγιστα κρατικά μυστικά, διαβαθ…

2018-08-16 19:49

Pauline Dewberry Lazypaws

Passionate about animal welfare; love cats; hate cruelty to animals. Writing 3 books.

RT @Nicholas_Rossis: "Happy people feel worthy of other people's love, whereas unhappy people don't" #Pearseus #1 epic fantasy …

2018-08-16 19:49

Giorgos Vrakourakis vrakourakis

RT @parodynews: Mαροκινοί,Αλγερινοί και Πακιστανοί έχουν προσαχθεί για το έγκλημα του νεαρού 25χρονου φοιτητή στου Φιλοπάππου. ΔΥΟ χρόνια τ…

2018-08-16 19:49

Neverland TheNever_land

“The moment you doubt whether you can fly, you cease for ever to be able to do it.”J.M. Barrie,Peter Pan

RT @hamogelo: ΑΙΣΙΟ ΤΕΛΟΣ ΣΤΗΝ ΠΕΡΙΠΕΤΕΙΑ ΤΗΣ ΝΙΚΗΣ Π., 16 ΕΤΩΝ. Σας ευχαριστούμε όλους για το ενδιαφέρον και τη συμμετοχή σας. …

2018-08-16 19:49

to skathari toskathari

women-sex and gambling

Εξάδα με απόδοση 93.31

2018-08-16 19:49

Καμμένο Τσιπάκι kammenotsipaki

Θες και bio? Δεν υπάρχει...Κάηκε... I am for the festivals...Μουσικορομαντικοκαφρικό ακκάου...

RT @ma_mounaki: Χαχαχχαχαχαχ κλαιωωωωω ποπηηηη κλΑιωωω τι μου θύμισες

2018-08-16 19:49

Christina Dim ChristinaDim31

Αρσάκειο Τοσίτσειο Εκάλης

RT @IoannisMoiras: Από το πρωί ψάχνω στο διαδίκτυο απάντηση-διάψευση από ΑΝΤ1 και Μητσοτάκη στη δημοσιογραφική αποκάλυψη ότι το κανάλι διέθ…

2018-08-16 19:49

Nora Schouten NoortjeSchoute

Whatever interests me, and, hopefully, you, too! 🌊, #TheResistance. 🚫 Dm and 🚫 Porn

RT @Marina_Moscha: Καλημερούδια!!!🌷

2018-08-16 19:49

shamrock☘️1404 shamrock1404

Ειδικός απαξιολόγος..Πρασινοαίματος..Ναζίδια ψόφο! #PANATHINAIKOSFCAGAIN

@greg_christou Εσύ το πέρασες...Τί να πούμε κι εμείς που έχουμε ακόμα μια βδομάδα, για να φάμε το πακέτο αυτό.. 😜😜

2018-08-16 19:49

Georgia Garantzioti GarantziotiGeo

Communication & Mass Media 🎓 Journalist at SKAI TV & Radio 100.3 @skaigr
«Never say never because limits like fears are often just an illusion» M. Jordan

photo credits: aidinidiss #skainews #skaitv #online #reportage #news #work #studio #tvshow #tvnews #journalist…

2018-08-16 19:49

to skathari toskathari

women-sex and gambling

Εξάδα με απόδοση 93.31

2018-08-16 19:49

Julie Wark JulieWark

Traductora. Autora del libro Manifiesto de derechos humanos y de Against Charity (con Daniel Raventós), 2018

RT @yanisvaroufakis: The desertification caused by the permanent debt bondage imposed upon Greece by the troika is now acknowledged with a…

2018-08-16 19:49

Δον Καμήλος🎩 PapariaMantoles

Για τους φίλους σκέτο Δον.

RT @38_shopgirl: Είναι εδώ κάτι Βέλγοι έχουν ξεπατωθει στη χωριάτικη σαλάτα, βουτάνε το ψωμί στο λάδι, πρέπει να έχουν φάει 2 κιλά. Olive o…

2018-08-16 19:49

ChristoK. Christosk66

ΜΟΝΟ ΘΛΙΨΗ... ΤΙΠΟΤΑ ΑΛΛΟ..

Το Κίνημα "ΔΕΝ ΠΛΗΡΩΝΩ" συνεχίζει την δράση του και επί ΣΥΡΙΖΑΝΕΛ

2018-08-16 19:49

Nikos Papadojannis N_Papadojannis

An unmade bed of a man.

@AlexKennedyNBA @Giannis_An34 Neof*ckingnazis jn his own home country are the only people who actually hate Giannis.

2018-08-16 19:49

franchin01003 franchin01003

Una vita che miri principalmente a soddisfare i desideri personali conduce prima o poi a un'amara delusione.

RT @AlikiKokkinou: Καλημέρα ☀🐬🌻😊☕

2018-08-16 19:49

christina🤸‍♀️🤸‍♀️ christinaxep

Είμαι η αδερφή της @fainipap 🤔😜

RT @MOTOSPORTINK: -Πόσο χρονών είσαι ;
-Τέτοια εποχή διάλεγα ποδιά από το Μινιόν

2018-08-16 19:49

Nko 🇬🇧🇬🇷 notacrook1

🌞 🍁 😂 bun your hype

@BillyMaddison6 @Main_hu_Gaurav @davemeltzerWON What 2 wrongs are you talking about 🤔 what ‘same thing’ are they do…

2018-08-16 19:49

korina kori_lz

💚Panathinaikos🍀
If opportunity doesn't knock, build a door!!!

@Giannis_Vl @mariakouklakh @drazen_11 @eniiii2 @AnnaTh_9 @andreas_zar @dimkost13 Ωραία. Να βγάλουμε προειδοποίηση σ…

2018-08-16 19:49

pistepseto pistepseto

😋

Φαγητά και γλυκά σερβίρονται με αρκετή φαντασία και το αποτέλεσμα είναι εντυπωσιακό

2018-08-16 19:49

Maris Pascual MarisPascual6

Entertainment Basketball World News Music Politicians Local Sports Weather News

RT @tabisula_grace: Ganda mu talaga mamameh @MissMarisRacal di vah papapeh @OneInigoPascual love u both...ingat kau always

TeaserSoon ForI…

2018-08-16 19:49

gordon cruickshank blackmcdonald13

RT @yanisvaroufakis: The desertification caused by the permanent debt bondage imposed upon Greece by the troika is now acknowledged with a…

2018-08-16 19:49

σαρδέλααα MariaStath751

If it's about music and wine, I'm in!

RT @Nina_teachergr: Να του αναστατώνεις το μυαλό..να σε αναζητά κάθε λεπτό..(κ ας μην το παραδέχεται)... Μπορείς?!?

2018-08-16 19:49

Chad Culver CCulverRMA

RT @gridironglory: Back in 2005 Kevin Culver was named GG Player of the Year....catch him at media days with the rest of the Culver family…

2018-08-16 19:49

γ🍴τί♂️ __gati__

Φαγανός κεραμιδόγατος,💙:🍕,🌞,🍉,🌊.

RT @themismav: Λίγο κρασί,λίγο θάλασσα και το στόρυ μου

2018-08-16 19:49

Emmanouil Savoidakis savoidakis

going the distance.

@th4lis Or how it didn’t; this charming myth has been debunked by German historian Heinz Richter:

2018-08-16 19:49

Morgan Campbell M_Campbell23

Ex cricketer, proud father of 3 awesome teenagers, cricket commentator, poker player, a huge fan of 80's music & still single Instagram is @shanewarne23

RT @yanisvaroufakis: The desertification caused by the permanent debt bondage imposed upon Greece by the troika is now acknowledged with a…

2018-08-16 19:49

deformed arisb1978

@scirocco1908 με πασοκ πληρωναμε το δανειο χωρις να το εχουμε παρει 😂😂🕺

2018-08-16 19:49

Travis Bickle tbickle1976

Programmer, cynic and sarcastic.

RT @anasakamou: Επαγγελματίας επαναστάτης #συντομο_ανεκδοτο

2018-08-16 19:49

mamouni ma_mounaki

Σε καθε σπιτι ενας τρελλος και στο δικο μας ολοι!!!!!!!! Εγω γελω με 12 κι οι 13 με μενα!!! Smart, Beautiful and ... Liar !!!!

@DKatsihtis Δεν ξέρω Μαλλον με επηρεασε η βροχή

2018-08-16 19:49

christina🤸‍♀️🤸‍♀️ christinaxep

Είμαι η αδερφή της @fainipap 🤔😜

RT @__gati__: Ή που δεν θα πέφτει καμιά οδοντογλυφίδα από την τρύπα ή που θα προσπαθούν να βγουν τέσσερις μαζί.

2018-08-16 19:49

Σουζη.iam Suzi🙋🌟 OOd7LUjDOQ18cbr

Ειμαι για ολες τις φαντασιωσεις ..ΟΧΙ τσοντωακαουν..Μου αρεσει το χιουμορ.
(ΤΟ ΠΑΛΙΟ ΠΡΟΦΙΛ ΔΕΝ ΙΣΧΥΕΙ)

RT @AnnaVerouli: Μερικοί άνθρωποι έχουν ανάγκη να ψάχνουν τη δυστυχία σε οποιαδήποτε κατάσταση.
Επισημαίνουν το παραμικρό λάθος,την οποια έ…

2018-08-16 19:48

Attica Coast AtticaLife

Η ζωή δίπλα στο απέραντο ελληνικό γαλάζιο: Πέραμα, Πειραιάς, Φάληρο, Άλιμος, Ελληνικό, Γλυφάδα, Άγιος Κοσμάς, Βουλιαγμένη, Βούλα, Σούνιο

Στη μεταμνημονιακή Ελλάδα δεν θα είναι όλα ρόδινα!

2018-08-16 19:48

christina🤸‍♀️🤸‍♀️ christinaxep

Είμαι η αδερφή της @fainipap 🤔😜

RT @gioxar1: Τι λες ρε μάγκα σοβαρά? Γράφεις καλά, σ αρτάρω κάθε μέρα κι εσύ ούτε ένα για δείγμα? Ούτε ένα από ευγένεια? Τίποτα δεν σ αρέσε…

2018-08-16 19:48

Wolff+d'Orsay wolffdorsay

#CSR, Strategic #Philanthropy, #BusinessEthics | Specialist Consulting & Training | W+d'O... We Stand for Good Business. RT≠endorsement

RT @yanisvaroufakis: The desertification caused by the permanent debt bondage imposed upon Greece by the troika is now acknowledged with a…

2018-08-16 19:48

Van Kir vankir9

RT @VPetsopoulos: Λεφτά πιάνω, καπνός γίνονται

2018-08-16 19:48

Christa Christa23368401

ο,τι θελω ειμαι ο,τι θελω κανω. εσεις με ξερετε απ'αυτα που γραφω.

RT @theogiannaros1: 2) Είναι αλήθεια, υπουργέ της μαντινάδας, πως προς ΟΛΑ τα δημόσια νοσοκομεία, υπάρχει κρυφή εντολή να περιοριστούν στο…

2018-08-16 19:48

Backstage24.gr backstage24gr

Όλο το παρασκήνιο είναι εδώ...!

Ρούλα Ρέβη: Η πιο τρυφερή φωτογραφία του instagram (ΦΩΤΟ) -

2018-08-16 19:48

Xavier Subía SubiaXavier

🇪🇨30 felices años de matrimonio, 2 hijos ya grandes en todo sentido. Apasionado de mi trabajo y haciendo montaña ¿Qué más se puede pedir a la vida?

@rebroAS @mserranoduenas Muy cierto. Miy buena foto.
El Illiniza y la Tionisa.

2018-08-16 19:48

Η Κορέα Ελένη parkopoulou

η πρώην του Κιμ

RT @MrArkadin13: δεν θέλω να προκαλώ
αλλά να 'μαι

2018-08-16 19:48

ayilenizin vera'sı † Hayirlivera

kutup ayısı anası, peynirci .μόνο ο θεός μπορεί να με κρίνει BJK

@laikci Ehehehhehe gravyer

2018-08-16 19:48

alekoglou katerina alekogloukateri

είμαι από τη Θεσσαλλλονίκη και με αρέσει

RT @Philognosia: 16.8.1936: ο δικτάτορας Ι. Μεταξάς, μιμούμενος τις πρακτικές των ναζί, οργανώνει το κάψιμο βιβλίων με «ανθελληνικό» περιεχ…

2018-08-16 19:48

ΠιτσιΦρικη pitsifree

Μου 'χεις κάνει το βίο αβίωτο

RT @Dunkel_Fee: Αν είμαστε οτι νιώθουμε, πρέπει σήμερα να μοιάζω με Λερναία Ύδρα και ο Ηρακλής λείπει στο χωριό

2018-08-16 19:48

Edelmann Edelmann1967

RT @elgrig49: Πριν 2 χρονια στο πεζοδρομο Θησείου, αποστολου παυλου, τεληη σεπτεμβριου, 8 μμ, ληστεψαν την κορη μου με απειλη οπλου, η απαν…

2018-08-16 19:48

Αποστόλης Tolispasp

Μισώ το καλοκαίρι, τα ψητά ψάρια και την Σέρσεϊ Λάννιστερ.

RT @beatBukowski: το χοντρύνανε πολύ

2018-08-16 19:48

Pantelis Chiotellis pantelischio

Pantelis Chiotellis #DigitalMarketing Social Media Marketing Strategist | HubSpot Inbound Marketing & Email Marketing Certified | #MarTech #Chatbots

RT @naftemporikigr: Έως 31 Αυγούστου τα εκκαθαριστικά του ΕΝΦΙΑ #enfia

2018-08-16 19:48