Tweets at Kesariani around 30km

It searches the Pokestop Tweets of Twitter around Kesariani 30km.


Search Results

George Sambalis sambalis

General Surgeon - Laparoscopic Surgeon. Director of Surgery, Euroclinic of Athens

Σας παρουσιάζω ένα video-συνέντευξη στο Χειρουργείο της Ευρωκλινικής, την ώρα της εκτέλεσης μίας σύγχρονης λαπαροσκ…

2018-05-25 02:54

Angelina AngelinaPren

RT @toumvas: -Μου αρέσει να ξέρει ο άντρας να μαγειρεύει.
-Τώρα αν σου ότι από το πρωί σήμερα μαγειρεύω τι θα πεις;
-Πες μου τι μαγειρεύεις…

2018-05-25 02:54

Mary btsxmary

ARMY since 2016 • Instagram: mary.karag
My dream: go to a bts concert 🇬🇷

The accuracy 😂😂

2018-05-25 02:54

Ioannis Tomkos ITomkos

Ioannis tweets mostly about Telecoms/Datacoms (fields where he is a well know expert in the relevant academic and business communities).

With some Greek members of the BlueSpace project team in the Center of Madrid

2018-05-25 02:54

Rosa Louminoasa

RT @argie810: ...και το φεγγάρι ακόμη στο γέμισμα του..
γεμίζει απο τις χαρές μας .. τις λύπες.. τις ανησυχίες μας.. τα καρδιοχτύπια μας..…

2018-05-25 02:54

Συνάναρχος Αναρχος nrpRlDyLYll2B0R

@babinistas @ArisPortosalte @babis2009 Αρη ο Μπάμπης είναι το άλλο σου 3/4..

2018-05-25 02:54

تعلووب الشهلووب ♠ ElHeroo

‏‏هذا الاكونت ينصح به بكار والمغامرون الخمسه والمفتش كونان ♻ .. لا يتبع لم هم دون ال🤪🔞

RT @vip_qaisar: "لو عشت كلّ حياتك كأنك في رمضان ستجد الآخرة عيد"

كم رمضان عاهدتك فيه أن لا أعود للمعاصي ثم عدت
وكم من رمضان وقفت بين يديك…

2018-05-25 02:54

Motto~Motto mmotto113

🐶🐹🐾🐾Motto~Motto

RT @elinampounia: Βρέθηκε σε πολύ άσχημη κατάσταση στο δρόμο,καταδαγκωμενη από σκυλιά.Έγινε καλά,εμβολιαστηκε,στειρωθηκε κ αναζητά οικογένε…

2018-05-25 02:54

Κρίνος_ο_σκέτος Louloudi5

Μυρισε με δικη σου ευθυνη!!!

RT @MOTOSPORTINK: -Που είναι χαμένος ο τακης ρε τόσο καιρό ;
-Σε ένα βρακι

2018-05-25 02:54

Filathlos.gr filathlosgr

Συνεχής ενημέρωση από το πρώτο αθλητικό blog στην Ελλάδα. Μπείτε στη σελίδα μας στο

Βλάχος: «Θέλουμε το νταμπλ μπροστά στον κόσμο μας»

2018-05-25 02:54

George Roussos baphometx

Εραστής της 7ης Τέχνης - Κυνηγώντας @chimeres & ταξιδεύοντας παλαιότερα σε: @sodeia_net @cinefreaks @SevenArt_gr
Συνεργάτης του @tvxs

How new EU data protection regulations affect the art world

2018-05-25 02:54

Nullus Anxietas karmakosmische

The path of my life is strewn with cowpats from the devil's own satanic herd

@koukouvagia_ κλεφτες θα γινουν οι ντιπιοζ;

2018-05-25 02:54

ΑΠΕ-ΜΠΕ amna_news

Αθηναϊκό - Μακεδονικό Πρακτορείο Ειδήσεων: το εθνικό ειδησεογραφικό πρακτορείο της Ελλάδας |English: @amna_newseng |Sport: @praktoreiosport

Λ. Κονιορδου στο Συμβούλιο Υπουργών της ΕΕ: Η υπερφορολόγηση έχει δραματικές επιπτώσεις στην αγορά έργων τέχνης και…

2018-05-25 02:54

cocojombo veysiyenigl

RT @Cipras: N'oldu lan laleler? Dalga geçiyordunuz bizle.

2018-05-25 02:54

Julia Julialepa

Η σωτηρία της ψυχής....εξαρτάται από την ίδια την ψυχή!!

RT @Dasydo: -❤️ΤΙ ΤΟ ΙΔΙΑΙΤΕΡΟ ΕΧΕΙ Ο ΑΝΘΡΩΠΟΣ ΠΟΥ ΑΓΑΠΑΣ;
-ΤΙΠΟΤΑ. ΤΟΝ ΑΓΑΠΩ ΚΙ ΑΥΤΟ ΕΙΝΑΙ ΠΟΥ ΤΟΝ ΚΑΝΕΙ ΙΔΙΑΙΤΕΡΟ!❤️

2018-05-25 02:54

protothema.gr protothema

Greece’s No. 1 news site & best-selling Sunday newspaper. Follow for breaking news, special reports and more from
@protothema / #protothema

«Στόρμι για πρόεδρος» φώναζε ο κόσμος: Λατρεία για την πορνοστάρ του Τραμπ στο West Hollywood

2018-05-25 02:54

BankingNews.gr bankingnewsgr

Έγκυρη online οικονομική ενημέρωση

Νέες βαρύγδουπες δηλώσεις από τον Αυστριακό Καγκελάριο

2018-05-25 02:54

Julia Julialepa

Η σωτηρία της ψυχής....εξαρτάται από την ίδια την ψυχή!!

RT @Dasydo: ❤️ΡΟΛΟΣ ΤΟΥ ΑΝΔΡΑ ΕΙΝΑΙ ΝΑ ΣΕΒΕΤΑΙ ΤΗ ΓΥΝΑΙΚΑ. Ο ΡΟΛΟΣ ΤΗΣ ΓΥΝΑΙΚΑΣ ΕΙΝΑΙ ΝΑ ΤΟΥ ΔΙΝΕΙ ΛΟΓΟΥΣ ΓΙΑ ΝΑ ΤΗ ΣΕΒΕΤΑΙ❤️
🍒💜🍒 …

2018-05-25 02:54

Aggelikh Aggelthomas

RT @StavrosSofronas: Η ζωή κάθε ανθρώπου, ειπωμένη αληθινά, είναι ένα μυθιστόρημα.
Ernest Hemingway

2018-05-25 02:54

ioannis giakoumakis Ergon73Ioannis

Ελευθερος Ανεξαρτητος Απροσκυνητος Αντιμνημονιακος

Πλακα πλακα κατι μικρα " παιδακια " δεν τους
αφηνουν τωρα να κοιμηθουν,,,,,ησυχοι !!!
Ποια να ειναι αρα…

2018-05-25 02:54

Alexander greekdude

News junkie, serial blogger. Chronicler of @AthensTransport, enthusiast for the aesthetics of @DesertedPlaces.

(at last!)

2018-05-25 02:54

Jinni G. liljinnig

🕷️SELF-DESTRUCTION🕷️

RT @Loqiemean: желание бешеное имею

2018-05-25 02:54

Cornelius Leviathan CorneliusLevi

Ιστορικό στέλεχος γενικώς

RT @AthanDim: Χθες χάθηκαν 6 διδακτικές ώρες στα σχολεία.
Όχι γιατί είχαν οι δάσκαλοι συνδικαλιστικές εκλογές που γίνονται κάθε διετία, αλλ…

2018-05-25 02:54

Μπόνι Μπλού Μπάτλερ MareNicoleTzo

άφτερ ολ τουμόρροου ις ανάδερ ντέη /no dm/ φίλη μου @Katia_katiabla 💖🌷

RT @mikromary: Εντυσε μουσακά την ταινια, διαβασα

2018-05-25 02:54

Grande Rock ezine granderockcom

It's the music that matters the most so, we are here to promote good rockin' music... nothin' more or less...

Mad Max to release new studio album “35” on August 10th 2018 - #SPV #Steamhammer

2018-05-25 02:54

Μπόνι Μπλού Μπάτλερ MareNicoleTzo

άφτερ ολ τουμόρροου ις ανάδερ ντέη /no dm/ φίλη μου @Katia_katiabla 💖🌷

RT @mikromary: Ο μόνος στοχος που βαζω, ειναι το που θα παμε να φαμε με τους φιλους μου τα Σαββατοκύριακα

2018-05-25 02:54

Active Limbic System ActiveLimbicSys

Active Limbic System is a trance group created by the Greek duo of George Tripas and Michalis Patakas.

Μου άρεσε ένα βίντεο @YouTube Giuseppe Ottaviani LIVE 2.0 Australian tour 2018

2018-05-25 02:54

Μπόνι Μπλού Μπάτλερ MareNicoleTzo

άφτερ ολ τουμόρροου ις ανάδερ ντέη /no dm/ φίλη μου @Katia_katiabla 💖🌷

RT @mikromary: Αυτο που παιρνετε ενα τραγικο γεγονος κ κανετε κακεντρεχη σχολια ή προσπαθειτε να το γελοιοποιησετε, με στεναχωρει αφανταστα

2018-05-25 02:54

Μπόνι Μπλού Μπάτλερ MareNicoleTzo

άφτερ ολ τουμόρροου ις ανάδερ ντέη /no dm/ φίλη μου @Katia_katiabla 💖🌷

RT @mikromary: Με βλεπει κατω να κοιταω το πατωμα κ με ρωτα "Τι επαθες εσυ; "
Επεσα με τα μουτρα στη δουλεια, μπος

2018-05-25 02:54

spyrosbotsas spyrosbotsas

2018-05-25 02:54

Unicorn Lovin’ 🦄☺️ SimplyLola__

I don’t know what I’m doing or who I am, but I’m sure I’ll figure it out - eventually 💫

RT @AlliCatWilliams: Following your passions is cool, but money is also cool. Plus, we live in a capitalist nation. Choosing a major or pro…

2018-05-25 02:54

Helen bhelenr

Archer Addict, Pen Llyn, Greek Isles & LFC

RT @ATHNICO: Athens now.Mobilephoto by me.Greece!!!

2018-05-25 02:54

Μπόνι Μπλού Μπάτλερ MareNicoleTzo

άφτερ ολ τουμόρροου ις ανάδερ ντέη /no dm/ φίλη μου @Katia_katiabla 💖🌷

RT @mikromary: Μερεντάκι μιραντάκι
χτιστηκε τουτο το κορμακι

2018-05-25 02:54

Kostas Papakostas (aka ΘείοςΚώστας) gmkpapakostas

Έλληνας επιχειρηματίας χωρίς οφσόρ...

@YakinthosK @4everRedskin Λογικό, ποτέ δεν ήταν αυτόφωτη, την πλάσαραν λόγω ονόματος και μόνο.

2018-05-25 02:54

Κανάλι ® kanaliotis

Αν δεν αποδοθεί δικαιοσύνη για όλα όσα όλοι γνωρίζουμε ότι έγιναν τα τελευταία χρόνια, δεν υπάρχει περίπτωση να δούμε άσπρη μέρα σαν χώρα!!!

...
Και έτσι, όλη τη νύχτα, ξαπλώνω δίπλα από
την αγαπημένη μου, τη ζωή μου και τη γυναίκα μου
στο μνήμα δίπλα από…

2018-05-25 02:54

Eu_incorruptible #FBPE eu_father

Law and economics -Fiat iustitia, et pereat mundus.- 🇪🇺🇬🇷🇬🇧☘️

RT @vivian_e: Τα ταμειακά υπόλοιπα θα μεταφερθούν στην ΤτΕ κ θα εποπτεύονται από την Κομισιόν που θα λαμβάνει ενημέρωση ανά δίμηνο. Ετσι, Τ…

2018-05-25 02:54

Aggelikh Aggelthomas

RT @GiotaGiota6: ~θα περάσω από αυτή τη ζωή μόνο μια φορά(!)
Αν μπορώ να κάνω κάτι καλό η να πω κάτι καλό,πρέπει να το κάνω τώρα🌹🌼
Γιατί δε…

2018-05-25 02:54

BillyZ zbbilly

RT @ganavalo: #Με_τις_υγειες_σας

2018-05-25 02:54

Saskia Baas MsSaskiaBaas

Researcher & Activist // Civil War Violence / Accountability for International Crimes / Forced Migration / #Syria / #Sudan // @DSP_Syria

RT @daniel_howden: What’s happening in Niger is what the EU would like to replicate throughout sub-Saharan Africa. Find out more …

2018-05-25 02:54

Andreas Tsounis AnTsounis

Η κ. Γεννηματά σημείωσε ότι το Κίνημα Αλλαγής ασκεί προγραμματική αντιπολίτευση, ενώ επικαλέστηκε τη θετική παρουσί…

2018-05-25 02:54

Kontra Channel KontraChannel

Αττική: 52 & 49 UHF (DIGEA) / NOVA: 852 / OTE TV: 651 / LIVE STREAM:

Πηγές ΥΠΟΙΚ: Συνολική συμφωνία για το χρέος στις 21 Ιουνίου |

2018-05-25 02:54

johnny1248 JediFlippyDoer

Just an ordinary man doing ordinary things. Not so out of the ordinary.

@Shivam_Murari @ThePerezHilton And also, let's hopefully get a performance from Taylor Swift at the #MTVEMA in 2019…

2018-05-25 02:53

George Mitropoulos gmit20

Εχω καλη μνημη αλλα δεν είμαι μνημονιακος. Αγαπαω τα ζωα αλλα μονο τα τρετραποδα.Δηλωνω Παναθηναικος.

@anny_v10 Σου διαφευγει μαλλον οτι η αναπτυξη θα ειναι ολιστικη!

2018-05-25 02:53

εξωγήινος® gournakisp

instagram pgournakis dont drink and drive just smoke and fly

RT @spanio_pouli: Αφού κατηγορούν και τον Morgan Freeman για σεξουαλική παρενόχληση..σταματάω να κρίνω απο την όψη ανθρώπους..προφανώς δεν…

2018-05-25 02:53

legitgaminggr legitgaminggr

Gaming YouTube Channel. Παίζω βιντεοπαιχνίδια στο ίντερνετ, δηλαδή. Αυτό.

@tinyBuild Nothing yet. Why you do this to me @tinyBuild ? :<

2018-05-25 02:53

matrix24GR matrix24gr

Αποκλειστικές ειδήσεις, Αναλύσεις, Παραπολιτικά. Σπάμε τον κώδικα της ενημέρωσης.

Το χρονοδιάγραμμα της αξιολόγησης στο Δημόσιο

2018-05-25 02:53

تعلووب الشهلووب ♠ ElHeroo

‏‏هذا الاكونت ينصح به بكار والمغامرون الخمسه والمفتش كونان ♻ .. لا يتبع لم هم دون ال🤪🔞

RT @vip_qaisar: ولو ف يوم راح تنكسر لازم تقوم واقف كما النخل باصص للسما للسما☝️

ولا انهزام ولا انكسار ولا خوف ولا ولا حلم نابت ف الخلا ف ا…

2018-05-25 02:53

Szechuan Sauce AlliCatWilliams

There’s nothing I can’t do. Go Dawgs.

Feminism and misandry are not the same thing. Some of y’all want to completely eradicate the male sex bc you have p…

2018-05-25 02:53

Kostas KostasSpiderman

/> Η Κ Α Λ Υ Τ Ε Ρ Η είδηση για το 2018 !!! ❤️🧡💛💚💙💜

2018-05-25 02:53

Anna costala Dasydo

Scrittrice greca per i bambini. Τα παραμύθια είναι το κλειδί για να καταλάβουν οι μεγάλοι τον εαυτό τους...

RT @JoannaStauropo1: Κανείς δεν πρόκειται να σου επιστρέψει τα χρόνια σου.Η ζωή δεν πρόκειται να αναστρέψει,να περιορίσει, την πορεία της.…

2018-05-25 02:53

🇪🇨César Hernández CE5ARHDEZ

El único día fácil fue ayer. #BSC & #ForçaBarça #PepGuardiola

RT @diioannid: The future of #robots just might be soft #robotics! [#video] | @futurism via @MikeQuindazzi

#AI #ArtificialIntelligence #m…

2018-05-25 02:53

GreekAncientCosmos 123tgou

Fine Sculptures by Bronze and Terracotta.
Hand Made Artworks influenced by Ancient Greece.
'' O μεν βίος βραχύς , η δε τέχνη μακρά ''

Marathon Boy sculpture ....

2018-05-25 02:53

Paristzina paristzina

single

RT @Dasydo: @spyros78043899 @dimyboy ΑΛΗΘΕΙΑ; ΕΔΩ, ΣΤΗΝ ΑΘΗΝΑ ΜΟΝΟ ΨΥΧΑΛΕΣ ΚΑΙ ΜΠΟΥΜΠΟΥΝΙΤΑ!

2018-05-25 02:53

IRENE KARA sexy_gidi

Sister:@nadinekara./YOUTUBE:Queen Rena/Traveller/Dario Argento/Game of thrones/How to get away with murder/MY LIFE,MY RULES/HAKUNA MATATA/YOLO🤟🏽/IG:Irene Kara

RT @30__kai: Ο άλλος μας κάλεσε για περπάτημα για τη γιορτή του

2018-05-25 02:53

The Duke john_wayne_gr

Churches and dictators, politics and papers, everything crumbles sooner or later

@hatzitzortzis @Skolyx Παντως εισαι πολυ προσγειωμενος τυπος, χωρις μεγαλη ιδεα για τον εαυτο του. Δεν πιστευω τα β…

2018-05-25 02:53

asisnet.gr asisnet1

2018-05-25 02:53

koulouri nektaria koulnek

ΚΡΙΣΗ ΕΙΝΑΙ ΝΑ ΣΕ ΤΑΙΖΟΥΝ ΤΑ ΠΕΡΙΣΤΕΡΙΑ ΣΤΟ ΣΥΝΤΑΓΜΑ

RT @ganavalo: #Με_τις_υγειες_σας

2018-05-25 02:53

Petros Raptis raptispetros

RT @memasimon: Το αστείο με τους «μίζερους - κακομοίρηδες παρατηρητές» της ζωής σου είναι οτι θυμώνουν οταν τους πάρεις είδηση , σήκωνουν ψ…

2018-05-25 02:53

Spilios Kouvelis SKouvelis

the only people for me are the mad ones, the ones who are mad to live, mad to talk, mad to be saved, Jack Kerouac

@Tzager @VasilisXtM Αυτό που όλα τα άσχημα αρχίζουν από τη μεταπολίτευση και τελειώνουν στη χούντα να το κοιτάξετε.

2018-05-25 02:53

MarisaConstantinides Marisa_C

Teacher educator; DOS; co-founder/ moderator of #ELTchat; blogger

@angelos_bollas @SueAnnan The term "good language learner" implies the opposite but was used here to recall all th…

2018-05-25 02:53

Vape Traveller vapetraveller

How much nicotine should i use. via /r/Vaping101

2018-05-25 02:53

nik fars NFars

Δεν αρέσω σε όλους αλλά δεν με ενδιαφέρουν όλοι .. !!

RT @argie810: ...και το φεγγάρι ακόμη στο γέμισμα του..
γεμίζει απο τις χαρές μας .. τις λύπες.. τις ανησυχίες μας.. τα καρδιοχτύπια μας..…

2018-05-25 02:53

Μαχητής parisnouki

Ο Δρόμος του Μαχητή είναι μοναχικός. Πρώην Καταδρομέας-Χειμερινός κολυμβητής. Το να ηττηθείς είναι προαιρετικό. Ο Μαχητής επέστρεψε!!

RT @altanitsa:
You are always on my mind...

2018-05-25 02:53

Xray Golf gioxar1

47 ετών φωτός, μουντρούχος απαισιόδοξος ανασφαλής τσαντίλας άδικος κομπλεξικός, θέλετε κι άλλα;
My favorite film

RT @DonDCatcher: Πήγα gym, έλιωσα στο φιτνες κ όταν γύρισα έφαγα ένα ταψί γαλακτομπούρεκο για να επανέλθει το γλυκογόνο στους μύες.
Τι εννο…

2018-05-25 02:53

Μακρινό Ριμπάουντ ddio031

Έχω νεύρα...

RT @30__kai: Ο άλλος μας κάλεσε για περπάτημα για τη γιορτή του

2018-05-25 02:53

Gf fokaG1

RT @gioxar1: Πήρα τηλέφωνο σε ξενοδοχείο για κράτηση, με ρώτησαν πως ονομάζομαι κ τους είπα Xray Golf
Με κάψατε ρε μαλάκες

2018-05-25 02:53

Skiron miaoumio

Για να μην είστε οι βασανισμένοι σκλάβοι του χρόνου,
μεθύστε, μεθύστε χωρίς διακοπή!
Με κρασί, με ποίηση, με αρετή, όπως σας αρέσει.
"Charles Pierre Baudelaire"

2018-05-25 02:53

Antonis Theo antonyunique

What's up guys?!My name is Antonis and I'm 22 years old!!!I am a cook and I love music and games :)

I liked a @YouTube video BAN PEWDIEPIE

2018-05-25 02:53

Dimitra Galanopoulou. DimitraGalanop1

RT @agelaw_7: ασφαλώς.. Όπως άλλωστε και το "σαλτα και γαμησου" είναι ευχή οπότε
ΣΑΛΤΑ ΚΑΙ ΓΑΜΗΣΟΥ
#αληταρια
#στοργη_και_προδερμ https://…

2018-05-25 02:53

Spyros A ♋ spyros78043899

My Best Tweets:

RT @argie810: ...και το φεγγάρι ακόμη στο γέμισμα του..
γεμίζει απο τις χαρές μας .. τις λύπες.. τις ανησυχίες μας.. τα καρδιοχτύπια μας..…

2018-05-25 02:53

Butterfly Webradio ButterflyWebRad

Butterfly Webradio The best Web Radio 24 ώρες ακούμε τα καλύτερα

2018-05-25 02:53

Kostas Lanaras jokraniareflex1

Historian-Author. Global citizen interested in politics, armed conflicts, economy, ecology, humanitarian issues and others. Tweets in English and Greek.,

@SameralAtrush A question if i may. To what extend would you say these kind of racial antisemitic remarks and Holoc…

2018-05-25 02:53

☭࿖ Σταλίνας ο 2ος Δούκας της Κορνουάλης ☭࿖=💀 SPothitos

Adversary of statism.
Αdvocate of free Market & Expression.
C💀MMUNISM ➡Conviction of Meritocracy & Wealth➡ Redistribution of poverty ➡Αuthoritarianism

RT @john_wayne_gr: @thess_citizen @SPothitos Το ιδιο ειναι

2018-05-25 02:53

Gunner ogunner

Τύφλα να έχει ο Μάρλον Μπράντο. Brainy's the new sexy...

RT @astrogirl34: Όπως παρακαλάνε τώρα τα νιουζλέτερς να παραμείνουμε σε επαφή θέλω να παρακαλέσει κάποτε κι ο καριόλης

2018-05-25 02:53

Barbara Douka BarbDouka

German teacher and eternal book lover !

@mjarlidge Amsterdam? 😃

2018-05-25 02:53

saraH SarafknLee

- live your dash -

All about your mentality 💯💯

2018-05-25 02:53

Spyros Karagrigoriou SpyrosKarag

physiotherapist

2018-05-25 02:53

Μακρινό Ριμπάουντ ddio031

Έχω νεύρα...

RT @arisb1978: γονείς κάνουν μήνυση στο παιδί τους να φύγει απο το σπίτι και μένα η μάνα μου χει κάνει ασφαλιστικά μέτρα μην βγώ απο την πό…

2018-05-25 02:53

The king nikolastelos

Ο Βασιλιας Ζει. Ζητω ο Βασιλιας.

RT @arisfivos: Aναγνώσθα μου είναι μια ώρα δύσκολη του χωρισμού η ώρα, εγώ θα πάω σε φίλο και η γκόμενά μου δουλεύει.Η ευτυχία με αγκάλιασε…

2018-05-25 02:53

irpap1 irpap1

RT @scorpio_sent: Βλέπω ταινία και ρωτάει ο άλλος πως γίνεται να αγαπάς άτομα τα οποία δεν ταιριάζεις και σε φτύνουν.... απάντησε μ .....…

2018-05-25 02:53

Stella ☘ stellaki70

photographer, life is a click,capture it🐬
☘g13☘
👉 τουιτερικό αίμα με @ploutarx 👈

RT @DimitrisSotiri2: Τούρτες και αηδίες..

2018-05-25 02:53

Ecigitesztek ecigitesztek

Active vaper who loves mods, RDAs and big clouds. Staring at muscle cars in his freetime and tries to satisfy his endless gadget obsession.

RT @vapetraveller: Great Prices on Uwell, Kanger and Aspire Coils at via /r/ecig_vendors h…

2018-05-25 02:53

Sotiris Maniatis smaniatis1

Δημοσιογράφος σε κρίση και όχι λόγω ηλικίας

Τους απειλεί με πειθαρχικό ο Γιώργος Θαλασσινός στην ΕΡΤ Dimitris Kanellopoulos

2018-05-25 02:53

BinDNA bindna

DNA Sequence Generator

GCAGTTGTAGCTGAAACGGTTAACCGAGAAATTACAAATAGGCCCGACCACGCAGATTTGCAGTGCCTACCTCGAGTTCGGTGTTAATTAGGCAGGTCCGTCCTCTAATGCAACC…

2018-05-25 02:53

Sosoka 🎗️ sosoulinig

Together we stand, divided we fall...

RT @toumvas: -ΠΑΜΕ ΜΩΡΗ ΠΑΡΑΣΚΕΥΑΡΑΑΑΑ!
-Αύριο είναι Παρασκευή.
-ΠΑΜΕ ΑΥΡΙΟ ΜΩΡΗ ΠΑΡΑΣΚΕΥΑΡΑΑΑΑ!

2018-05-25 02:53

e-nea365 e_nea365

RT @agelaw_7: ασυζητητι perpetual bonds...

2018-05-25 02:53

BinDNA bindna

DNA Sequence Generator

CTCCGCAACGAGGATTTGCTGATACTTTGCTTAACGGTGCGCTCCCCTGGGAGAGCGTTCCCCCGTGCGGATAGATCTTGCACAGCGATCAATTTCAAATGGTTCATTCGTGGAC…

2018-05-25 02:53

BinDNA bindna

DNA Sequence Generator

TGTATGAGGAAATCTGAGAACTGTCCGCCGCGCCGGTCATGACTCTTCGGAATGTCATCGGAAGCTCGCTTCTCACAAAATGGGGGGATTGCACGGAACTCGCCCCACCAGTAAA…

2018-05-25 02:53

BinDNA bindna

DNA Sequence Generator

GGCGGCCCTTCATACCAGAATGCATATAACATCGGATAGGTTAGCTGTTGGGACAGCACTGCACCAACGGCGAGAGCCTTGATCGCCCCGGTCTAATTGGCGGCATGAGGGTTGC…

2018-05-25 02:53

7591..το στοιχειό 7bucPkrtFKuRX8V

ΙΩΑΝΝΙΝΑ.

@1_mariasou Μη ξεχνάς πως ο μπαμπάς, είναι σημαντικό γρανάζι στη showbiz.

2018-05-25 02:53

BinDNA bindna

DNA Sequence Generator

TCCTCCCATGCGGCAGAGGCCATGCAATTGCAGTGCGTCGTCATGAGAGACCCTAACTCGTGCGATGTAGCGCCCAATCAGACATTCAACATCGAGAGCCTACGCGGCTCACCCT…

2018-05-25 02:53

Julia Julialepa

Η σωτηρία της ψυχής....εξαρτάται από την ίδια την ψυχή!!

RT @Dasydo: ❤️ΟΤΑΝ ΑΡΝΙΟΜΑΣΤΕ ΕΝΑ ΚΟΜΜΑΤΙ ΤΟΥ ΕΑΥΤΟΥ ΜΑΣ ΧΑΡΗ ΣΤΗΝ "ΚΑΘΩΣ ΠΡΕΠΕΙ" ΕΙΚΟΝΑ ΜΑΣ, ΠΛΗΡΩΝΟΥΜΕ ΠΑΝΤΑ ΤΟ ΑΝΤΙΤΙΜΟ..❤️ …

2018-05-25 02:53

BinDNA bindna

DNA Sequence Generator

AACTGTAGCATTGAACTAGTATGAACGTTAGGCTTTGGGACATATTAAACAGCCCCCCCGCCTAGGGGGGGAAATGTGATGTTTAATTGTTACGGCCATGAGTGCTCCGGTTATA…

2018-05-25 02:53

star.gr wwwstargr

Το Twitter account του Star Channel's Site ➡️ /> 📌Ακουλούθηστε μας για να ενημερώνεστε για όλες τις ειδήσεις από την Ελλάδα και τον Κόσμο.

Κυριακάτικο brunch στο Χαλάνδρι!

2018-05-25 02:53

Alexis_The_Gre@t Alexandros_V84

Όσα περισσότερα ξέρεις, τόσο λιγότερο χρειάζεται να μιλήσεις..

RT @eva_niarxou: Ο,τι έγινε, έγινε ..🌹🌹

2018-05-25 02:53

BinDNA bindna

DNA Sequence Generator

ATACTGCGCGTAACCACGTGTTTAGTCGACGGCACGGCCTGGGCCGAATGACTGCCCGGATCCTTGAGTCTCGAACAGTGATCAGATTTTGATATTCGACATCCGCTCAGGCTAG…

2018-05-25 02:53

BinDNA bindna

DNA Sequence Generator

CTAACGGTTTAGCCATGTCCGGGTTGTGCTGTTTCCGTGTGCGGCTATTGTGCGAACCCACAAGAACGCGCGTAAGTGTCAACGCGTTGGATGTAGTCAAATCTGACGACTTGAA…

2018-05-25 02:52

geo geopara1ffl

i think i'm dumb, or maybe just happy.

RT @nikosdfs: Μόνο το γιου τιουμπ δεν μου έχει ζητήσει έγκριση για τα προσωπικά δεδομένα ακόμα, ώστε να δω βίντεο με κουταβάκια που τρώνε τ…

2018-05-25 02:52

Carol Sabel Blodgett sabelblodgett

Author of The Moncrief Legends series. Writer of #romance #paranormal #mystery #fiction #horror

RT @fueradesilencio: ...“There are those who speak and those who dream...” 🌙🔭✨ ~ ᘐҽjɑn SԵojɑnovic
ԹհօԵօ • Instagram/morfinations_planet htt…

2018-05-25 02:52

ioannis vrettos skfroller

οτι ξεχωρίζει δεν είναι χρυσός..;;

2018-05-25 02:52