Tweets at Kallithea around 30km

It searches the Pokestop Tweets of Twitter around Kallithea 30km.


Search Results

The TOC TheTOC_gr

Ο επίσημος λογαριασμός του The TOC. Eιδήσεις κάθε λεπτό

«Δεν ήταν όλοι ντόπιοι στην υποδοχή του πρωθυπουργού»

2018-08-22 17:12

Vassiliki vasskal

RT @giannakarra1: Γεια σας παιδιά, είμαι ο Γιάννης και σήμερα θα σας παρουσιάσω το επίπεδο των νοητικών μου ικανοτήτων.

2018-08-22 17:12

dim pap73 Pap73Dim

45 and i still love this world

RT @tribunegr: Μπόλτον προς Τουρκία: Αφήστε τον πάστορα για να λυθεί η οικονομική κρίση «σε μια στιγμή»!

2018-08-22 17:12

Konstantinos Aloupis aloupis_kon

Διεθνολόγος-Οικονομολόγος. Political junkie

@ant_autou Όταν το iq σου φτάσει το ποσοστό του ΣΥΡΙΖΑ, πούλα

2018-08-22 17:12

Nyxtoscopio.gr nyxtoscopio_gr

Καλλιτεχνική ηλεκτρονική εφημερίδα NYXTOSCOPIO

e-mail: nyxtoscopio@gmail.com

Μέχρι το ξημέρωμα το σημερινό γλέντι στην Κορινθία .

2018-08-22 17:12

D I M I T R A 🧡 demxcat

Ονειροπόλα 🔸 Κυκλοθυμική 😺
🔸

RT @exo_nevra: Έναν τρελό να βρούμε να συνεννοηθούμε γιατί με τους νορμάλ δεν βγάζουμε άκρη

2018-08-22 17:12

The TOC TheTOC_gr

Ο επίσημος λογαριασμός του The TOC. Eιδήσεις κάθε λεπτό

Deutsche Welle: Η σκοτεινή πλευρά του τουρισμού

2018-08-22 17:12

Kay jemenfous__

''When the revolution comes some of us will probably catch it on TV, with chicken hanging from our mouths'' and for me
starless and bible black..

@MyronAnag Α τι ωραία, καλή όρεξη :)

2018-08-22 17:12

Ελενη Καράμπελα elekara2410

Άνθρωποι που δεν σου χαϊδεύουν τ'αυτιά, είναι αληθινοί και ξηγιούνται σπαθί.Οι υπόλοιποι δεν μ'αφορούν..
Όχι θιασώτης των DM.

@homloizides Μεγάλη σοφία και αλήθεια αυτό!

2018-08-22 17:12

the_nanny frozen_mar_d

Assistant manager ανήλικων τέκνων 🙂

Ο μόνος λόγος ύπαρξης της μελιτζάνας είναι για να γίνεται παπουτσάκια...απο την άλλη, η μπαμια πρέπει να χρησιμοποι…

2018-08-22 17:12

Christof prasino_fistiki

40 φεύγα τρέχοντας είναι σκληρό♋️ με ♍️θα παντρέψω @julieJudaki

Αν για τα άλλα ζώδια το ενδιαφέρον, η φροντίδα και η αποκλειστικότητα είναι επιθυμητά,
σε μας τους Καρκίνους είναι προαπαιτούμενα...

2018-08-22 17:12

very-very χολοσκασμενη_ xoloskasmeni_

RT @paspar_tou: Να σχωράτε που δεν είχα σήμα σήμερα νε τι τώρα έχω αλλά κούνα κούνα νύσταξα και πέταξα και τα τουί στα ψάρια

2018-08-22 17:12

Vangelis vagtsal

Τι ζούμε ρε φίλε!

RT @PapOffice: ✔️

2018-08-22 17:12

Nasos Kostopoulos sakisko

RT @YioAngelopoulos: Κακοί τραπεζίτες πρωθυπουργοί σας κουρέψαν εκατό δις το χρέος, αναλφάβητα γίδια της πλατείας, αλλά θέλατε γιάνη και το…

2018-08-22 17:12

Bizznews.gr Bizznews

ΠΡΟΣΟΧΗ...ΤΣΙΜΠΑΕΙ!

Θλίψη! Πέθανε γνωστός ηθοποιός στα 43 του χρόνια μετά από άνιση μάχη με τον καρκίνο -

2018-08-22 17:12

ΤουΡταγχαμων toutagamwn

Ερημιτης των πολεων. Βαφτιστήρα μου η @athen_ang

@sofaki_kapa Απ'τα κανονικα η απ'αυτα που ψηνεις στα χειλη..;

2018-08-22 17:12

gialakias oddios

@annzabel Ενω οι Ζαχαριαδηδες Καρανικες και Σβιγγου ειναι καλυτεροι....

2018-08-22 17:12

georgikos georgios GGeorgikos

Μόλις δημοσίευσε μια φωτογραφία @ Άγιοι Πάντες Καλλιθέας - Φιλόπτωχο

2018-08-22 17:12

Popi Karava PKarava

Tweeting in a personal capacity. All views my own. Retweets not endorsement

RT @aloupis_kon: Να χεις τελειώσει το ΜΙΤ, να είσαι από τα μεγαλύτερα οικονομικά μυαλά της Ευρώπης και να σε πιάνει στο στόμα του ο mr 360…

2018-08-22 17:12

Konstantinos D. gnomeslair

Game urbanist and game designer, geographer of cities, planner of levels & urban environments. Enjoys constructing urban spaces people can play in.

Stunning, ZX Spectrum inspired L'Abbaye des Morts by locomalito

2018-08-22 17:11

very-very χολοσκασμενη_ xoloskasmeni_

RT @gioxar1: Πήγαμε σε μια ταβέρνα και παραγγείλαμε τόσα που στο τέλος απ την χαρά τους μας φέρανε για επιδόρπιο φρούτα γλυκά παγωτό και μι…

2018-08-22 17:11

Anichneftis Anichneftis

"Δεν υπάρχουν ιδέες.Υπάρχουν άνθρωποι που κουβαλούν ιδέες και οι ιδέες παίρνουν το μπόι του ανθρώπου που τις κουβαλάει" Ν.Καζαντζάκης

RT @dpatsis: @Anichneftis @konstevel ΜΙΤ πανεπιστήμιο ειδικό για το MITSOTAKI δεν το ήξερες αδιάβαστο σε βρίσκω

2018-08-22 17:11

TheWaletoneWizard Waletone_Wizard

Weary of media and establishment. Hopeful of socialism and anti-austerity. Music, jazz and family. [Reverse order of importance].

RT @yanisvaroufakis: Yesterday should be a day that our universities' media schools should use as an example of the establishment's undimin…

2018-08-22 17:11

Up_aLL_oN ApoLLoN_I

Όταν βαρεθώ θα το αλλάξω σε Up_aLL_oFF

RT @astrogirl34: Από υποχρέωση γελάμε, μη νομίζετε

2018-08-22 17:11

Up_aLL_oN ApoLLoN_I

Όταν βαρεθώ θα το αλλάξω σε Up_aLL_oFF

RT @astrogirl34: Όταν μας συμβουλευετε να μην μπλέκουμε με ηλίθιους πάλι για τον εαυτό σας μιλάτε, έτσι δεν ειναι;

2018-08-22 17:11

Love Radio 97,5 Love975

6: Δημήτρης-Ιωάννα, 10: Κατ. Γκαγκάκη , 12: Βάσω Λούκα, 15: Ποσειδώνας Γιαννόπουλος, 17: Δημ. Μηλιόγλου, 20: Θ. Χρίσταινας, 22: Β. Ιωάννου (#real_love_stories)

ΒΙΝΤΕΟ: Αυτά είναι τα χειρότερα μαγιό που κυκλοφόρησαν φέτος στη Μύκονο!

2018-08-22 17:11

Kirkis House PetShop KirkisHouse

2311242995

RT @hellenicpolice: Σ' ευχαριστούμε πολύ ANUK για όσα προσέφερες! Δεν θα σε ξεχάσουμε.
Στις 21 Αυγούστου 2018, η οικογένεια της Ομάδας Αστυ…

2018-08-22 17:11

parodynews parodynews

Dany Bleed: Broadcaster/ writer / blogger/ satirical beast

Η γελοιογραφία της ημέρας via @athensvoice

2018-08-22 17:11

christina🤸‍♀️🤸‍♀️ christinaxep

Είμαι η αδερφή της @fainipap 🤔😜

RT @kim_D_kim_D: Δεν χρειάζεται να εξηγούμε σε όλους, πως, που και γιατί

2018-08-22 17:11

Sugarakis Sugarakis

RT @PGPapanikolaou: Ο ένας (Τσίπρας) ξαναμπουρδούκλωσε στην Οδύσσεια τις Συμπληγάδες Πέτρες της Αργοναυτικής Εκστρατείας.
Οι άλλοι (ΝΔ) για…

2018-08-22 17:11

Michael Plaxton MichaelPlaxton

Law professor & writer: Implied Consent & Sexual Assault (MQUP, 2015); Sovereignty, Restraint & Guidance (Irwin, 2018); Nadon Diaries (w/ @cmathen) (UBC, 2019).

RT @davidrkadler: Living in London, I could feel — at every pub & party — the left consensus turning against Freedom of Movement.

This is…

2018-08-22 17:11

christina🤸‍♀️🤸‍♀️ christinaxep

Είμαι η αδερφή της @fainipap 🤔😜

RT @kim_D_kim_D: Και μ εκείνα και με τ άλλα γίναμε αεροπλάνα
*εξ ου κι η έμπνευση

2018-08-22 17:11

AskMen Greece AskMenGR

Ο μόνος τρόπος για να γίνεις καλύτερος άντρας

Πώς θα γίνεις πραγματικός Άτλας

2018-08-22 17:11

fayscontrol fayscontrol

Η Μαριάννα Βαρδινογιάννη στο πλευρό των πληγέντων της καταστροφικής πυρκαγιάς via @fayscontrol

2018-08-22 17:11

Αφροδίτη+🐢 stosynnefakimou

Άλλο το χιούμορ, άλλο η αγένεια.

RT @Alexandros_V84: Αν ανοίγουμε τα παράθυρα στην θέληση, σίγουρα θα μπούνε μέσα και οι όμορφες στιγμές!! Καλημέρα...

2018-08-22 17:11

silverado PeriklisPer

Γέλα με τα προβλήματα σου, όλοι οι άλλοι το κάνουν.

RT @pantelischio: Οδηγός για τα Google Analytics για Επιχειρήσεις #marketing #DigitalMarketing #μάρκετινγκ

2018-08-22 17:11

Catsionson catsionson

RT @GiorgosKyrtsos: Το πιο χυδαίο μέρος της ομιλίας Τσίπρα ήταν η επίθεση σε Παπαδήμο,Στουρνάρα.
Με τον Παπαδήμο θύμισε συμβολή του στο κλί…

2018-08-22 17:11

ChristoK. Christosk66

ΜΟΝΟ ΘΛΙΨΗ... ΤΙΠΟΤΑ ΑΛΛΟ..

@stelios_blum Ρε Στελάρα διάνοια αυτό λέω και εγώ.. Ποιος γαμεί τους νεκρούς... αυτή είναι η ιδεολογία των αριστερώ…

2018-08-22 17:11

Christos Xanthakis ChristosXanthak

το λέει η επιστήμη ρε φίλε!

2018-08-22 17:11

matrix24GR matrix24gr

Αποκλειστικές ειδήσεις, Αναλύσεις, Παραπολιτικά. Σπάμε τον κώδικα της ενημέρωσης.

Στην Κίνα ο Κοτζιάς

2018-08-22 17:11

Το Σtellaki exo_nevra

Δεν μ'αρέσουν οι μπάμιες και τα φασολάκια ορίστε το 'πα!
@FKatsakis she's like a sister to me!

Άντε να χειμωνιάσει σιγά σιγά να αρχίσουμε να βουτάμε κανένα κουλουράκι στον καφέ μας

2018-08-22 17:11

Marianna Winchester 🇬🇷 MaRiEnNwIn

ΜΑΚΕΔΟΝΙΑ ΕΛΛΗΝΩΝ ΓΗ🇬🇷 ΠΟΤΕ ΞΑΝΑ ΦΑΣΙΣΤΕΡΑ Πρώην Έφηβη Βουλευτής ΚΒ' Συνόδου ΒτΕ Junior Ambassador |superwholock| Ο ΚΑΙΡΟΣ ΓΑΡ ΕΓΓΥΣ🐧

RT @hellenicpolice: Σ' ευχαριστούμε πολύ ANUK για όσα προσέφερες! Δεν θα σε ξεχάσουμε.
Στις 21 Αυγούστου 2018, η οικογένεια της Ομάδας Αστυ…

2018-08-22 17:11

silver.shadow.hammer sil_sha_ham

30 years in IT taught me the more WYSIWYG apps get the less WYSIWYG users become.

RT @marilouzou: Ειστε κι εσεις που ψαχνετε τον πριγκιπα πανω στο αλογο, ειμαστε κι εμεις που ψαχνουμε εναν ανωμαλο ολη μας τη ζωη......

2018-08-22 17:11

lidia mndestaste

he’s like a curse. vote him

RT @NektariaLp: @ShawnMendes Follow everyone like this

#MMVAs #FFSingleInMyBlood

2018-08-22 17:11

Coral Λέγων coral3550

Το προσδόκιμο ζωής, μετονομάσθηκε σε προσδόκιμο επιβίωσης

RT @angie22gr: Όταν επιλέγεις ΑΥΤΟ για σύμβουλο ΠΘ και σε ενοχλεί το βιογραφικό του Παπαδήμου ή του Στουρνάρα...... Για το Δαφνί τουλάχιστο…

2018-08-22 17:11

georgikos georgios GGeorgikos

Μόλις δημοσίευσε μια φωτογραφία @ Άγιοι Πάντες Καλλιθέας - Φιλόπτωχο

2018-08-22 17:11

Giannis Mas gianismas

RT @madrachalos: Τι πρέπει να γίνει με την ΕΡΤ των 2200 υπαλλήλων . RT για μεγαλύτερο δείγμα

2018-08-22 17:11

Kay jemenfous__

''When the revolution comes some of us will probably catch it on TV, with chicken hanging from our mouths'' and for me
starless and bible black..

Έλα μου είπαν και μου είπαν πας να φτιάξεις ποίημα, σοβαρεψου πες ότι έχεις να πεις σε μια πρόταση.

2018-08-22 17:11

Sihab Mahmud SihabBD

জীবন খাতার শেষের পাতায়,
এঁকে দিলাম আলপনা,
আমার স্মৃতি পড়বে মনে,
যখন আমি থাকব না...!

RT @gizchinagr: #Xiaomi Mi Band 3: το νέο #update φέρνει τη λειτουργία Night Mode! #news #app

2018-08-22 17:11

Ευαγγελος Μιχελης muayVTM1VNbHQ8J

RT @PenelopeD10: Πήγε με στρατιωτικό ελικόπτερο και πλήρη μυστικότητα στο σημείο του άθλιου "διαγγέλματος". Ούτε οι δημοσιογράφοι δεν γνώρι…

2018-08-22 17:11

James Cartash ® JamesCartash

♎ IT Sys Admin - Οπαδός του ευρωμονόδρομου, φεντεραλιστής, ευρωλιγούρης, love παγκοσμιοποίηση και αναπολώ Pax Romana τα πιο ευτυχισμένα χρόνια ever..

Ξανά στις 700 μονάδες το ΧΑΑ, εν μέσω πανηγυρισμών του περιφερόμενου θιάσου για την έξοδο από τη φθηνή χρηματοδότησ…

2018-08-22 17:11

Kostis Vigos-san KostisVigosSan

Είμαι περιπτεράς. Αντικαπνιστής. Δεν ξέρω ποδόσφαιρο. Κάποιοι με είπαν και φιλελέρα. Σιχαίνομαι τους φασίστες, κόκκινους και μαύρους.

RT @TsoukaladakisG: Αυτό.
#ΠαραμΙΘΑΚΗ

2018-08-22 17:11

lidia mndestaste

he’s like a curse. vote him

RT @NektariaLp: Legend is the best and cute person always I love you so much @ShawnMendes

#MMVAs #FFSingleInMyBlood

2018-08-22 17:11

Arachnoid Arthropodon

Confused, Frustrated & Disillusioned

RT @gorgogol: Τραπεζίτη Π/Θ δεν είχαμε στη μεταπολίτευση, αλλά ανθρώπους που αγνοούν τη διαφορά τραπεζίτη από κεντρικό τραπεζίτη δόξα τω θε…

2018-08-22 17:11

PjB BartsPete

I woke to Kurdish cause after watching heroic stand in Kobani✌️whilst Turkey gloated of ISIS victory, #YPG #YPJ resistance turned Kobani into ISIS Stalingrad🔥

RT @kataygetos: Commander in #YBŞ: We promise to revenge for Mam Zaki
"Those traitors who participated in the martyrdom of Mam Zaki Sengali…

2018-08-22 17:11

Makis ή ο δεν καταλαβαινω τι εννοεις; gersklavenitis

@ninetaoriginal τόσο πολυ βαριέσαι να δουλέψεις που χάλασες και αυτόν??

2018-08-22 17:11

Ιωαννα AtithasiKardia

RT @beatBukowski: Λίγο καμένο

2018-08-22 17:11

Reporter.gr reportergr

Αναλύσεις και ρεπορτάζ για την οικονομία, την πολιτική, το χρηματιστήριο. Email: info@reporter.gr - Facebook:

ΣΚΡΑΤΣ: Κέρδη 2.194.541 ευρώ την προηγούμενη εβδομάδα

2018-08-22 17:11

Το παλιογατί m_mourouti

RT @DimitrisSotiri2: Η παιδική σου ηλικία καταστρέφεται όταν βλέπεις τον Μαγκάιβερ να μη μπορεί να φτιάξει το ίδιο του το αυτοκίνητο.. http…

2018-08-22 17:11

Σκέπτικ Άσχολ SkepticistGR

passive-aggressive, free-thinker, existentialist, agnosticist, ethicist, humanist, skepticist, antifascist κι άλλα σε -ist.

RT @gmkpapakostas: Κάποιες τέτοιες παρεμβάσεις είχε κάνει αν δεν με απατά η μνήμη μου και η χούντα...

2018-08-22 17:11

Reporter.gr reportergr

Αναλύσεις και ρεπορτάζ για την οικονομία, την πολιτική, το χρηματιστήριο. Email: info@reporter.gr - Facebook:

Μικτή η εικόνα στις ευρωπαϊκές αγορές

2018-08-22 17:11

Fortune Greece FortuneGreece

O ηγέτης της παγκόσμιας επιχειρηματικής δημοσιογραφίας

Ρώσος ΥΠΕΞ: «Αβάσιμες» οι νέες αμερικανικές κυρώσεις- Δεν θα μείνουν αναπάντητες

2018-08-22 17:11

NEWS 24/7 News247gr

Tο News 24/7 μεταφέρει την πραγματική είδηση με ταχύτητα, εγκυρότητα και συνεχόμενη ροή, εστιάζοντας στα ουσιαστικά γεγονότα της ημέρας.

Κυρίες και κύριοι, από εδώ ο Homer Simpson αν ήταν άνθρωπος

2018-08-22 17:11

ioannis giakoumakis Ergon73Ioannis

Ελευθερος Ανεξαρτητος Απροσκυνητος Αντιμνημονιακος

KAI ΠΟΥ ΕΙΣΑΣΤΕ ΑΚΟΜΑ,,,,,,ΛΙΓΟ ΑΚΟΜΑ
ΤΣΙΠΡΟΣΥΡΙΖΑΙΟΙ ΚΑΙ ΠΑΕΙ Η ΕΛΛΑΔΑ ΜΑΣ,,,

2018-08-22 17:11

Fortune Greece FortuneGreece

O ηγέτης της παγκόσμιας επιχειρηματικής δημοσιογραφίας

Μπόλτον: Η κρίση στην Τουρκία θα μπορούσε να τερματιστεί «μέσα σε μια στιγμή»

2018-08-22 17:11

astrogirl34 astrogirl34

Είμαι Γουάιλντλινγκ

RT @JamesASB: Με πήρε κι η μάνα μου τηλέφωνο να δει πώς περνάω, αν τρώω, αν φοράω ζακέτα το βράδυ που κάνει ψύχρα κι αν βρέθηκε επιτέλους κ…

2018-08-22 17:11

Panagiotis K.Syriopoulos PSurios

ΝΕΟΔΗΜΟΚΡΆΤΗΣ
ΕθνικοΦιλελεύθερος
ΟΝΝΕΔ Αχαΐας

RT @hellenicpolice: Σ' ευχαριστούμε πολύ ANUK για όσα προσέφερες! Δεν θα σε ξεχάσουμε.
Στις 21 Αυγούστου 2018, η οικογένεια της Ομάδας Αστυ…

2018-08-22 17:11

||||||| tOuz-tOuz ||||||| tOuztOuz7

Instagram @touztouz7

I run the show, any show...

RT @astrogirl34: Παιδιά αν φοράτε γκρίζο βρακί μην μας το δείχνετε, μας φτάνει το γκρίζο της ψυχής μας

2018-08-22 17:11

^catwoman^ plymenicatwoman

κοκκομπιλοβασιλακοκανεκόπτερο

RT @iandrio1234: Κυρανακη,ουτε κ εμείς θα ξεχάσουμε
τις Μίζες
τις Οφσορ
τις Λίστες κ την Ελβετία
τον Παναμα
την Κλοπή των Ταμείων
την Ληστ…

2018-08-22 17:11

Chris Giapitzis-Papandreou chrisgiap

Life, liberty and the pursuit of happiness |📍Maastricht 🇳🇱 | 🎈 Patras 🇬🇷 | 📚BA @uoaofficial | MA @maastrichtu | Politics, Classical Liberalism, Sports

RT @Mandravelis: Να σημειώσουμε πως ούτε τραπεζίτες έγιναν πρωθυπουργοί, ούτε υπουργοί έγιναν τραπεζίτες. Διαπρεπείς πανεπιστημιακοί έγιναν…

2018-08-22 17:10

AllStar Basket AllStar_Mag

The one and only basketball magazine in Greece! Κάθε πρώτη Τετάρτη του μήνα στα περίπτερα. allstarbasket@hotmail.gr

Στην Αθήνα ο Ράταν Μέις: “Να γίνω ο ηγέτης γκαρντ της ΑΕΚ” (video) μέσω του χρήστη @AllStar_Mag

2018-08-22 17:10

Pixel Perfect Beauty pperfectbeauty

MUA | Beauty blogger -

Μπορεί το καλοκαίρι να φτάνει σιγά σιγά στο τέλος του, όχι όμως και η αγάπη μου για gradient χείλη...
laneige_kr…

2018-08-22 17:10

Tolis V. tolisv

Sex, politics and coffee 🇬🇷🇬🇧🇮🇹🇵🇱

RT @madrachalos: Αρχίσαμε να χαϊδεύουμε αυτάκια για να βγούμε.
Δεν θα απολύσεις ΔΥ, δεν θα κλείσεις ΕΡΤ...

Το έχω ξαναπεί. Οι φιλελέδες στ…

2018-08-22 17:10

GiannisBks Giannisbks

Sit Back Relax and Enjoy 😉

RT @beatBukowski: Λίγο καμένο

2018-08-22 17:10

matrix24GR matrix24gr

Αποκλειστικές ειδήσεις, Αναλύσεις, Παραπολιτικά. Σπάμε τον κώδικα της ενημέρωσης.

Το «Έθνος» του Ιβάν προβληματίζει το Μαξίμου

2018-08-22 17:10

Εφημερίδα Η Άποψη H_Apopsi

Πολιτική και αθλητική εφημερίδα που κυκλοφορεί πανελλαδικά από το 2002 -

Σοκ στη Φλώρινα: 5χρονη έπεσε σε κώμα και εξέπνευσε

2018-08-22 17:10

PapOffice PapOffice

When nothing goes right, go left

✔️

2018-08-22 17:10

ЛАЇКОС ТУПОС laikos_typos

Λαϊκάτζα...

RT @astrogirl34: Αν πιστεύεις ότι ο χρόνος κυλά αργά, μπες στην ουρά με όσους ανεβαίνουν σε λεωφορείο του ΚΤΕΛ από την μπροστινή πόρτα.

2018-08-22 17:10

CrisP crispSV

Go ahead, make my day

Αμαλιάδα: Επιτήρηση με drone σε καμένες περιοχές | #naftemporiki

2018-08-22 17:10

Thomas Mavrofides blacktom1961

We shall not cease from exploration And the end of all our exploring Will be to arrive where we started And know the place for the first time. (T. S. Eliot)

RT @hellenicpolice: Σ' ευχαριστούμε πολύ ANUK για όσα προσέφερες! Δεν θα σε ξεχάσουμε.
Στις 21 Αυγούστου 2018, η οικογένεια της Ομάδας Αστυ…

2018-08-22 17:10

Door_Sam ntor_sam

Dora ♊ με ♎ ❤️❤️...proud mommy ❤️Music,movies, photography, thoughts .. whatever I like .no DM 🌹🌼🌸🌸🌷💐

RT @astrogirl34: Ψάχνω εισιτήριο, οι τιμές στο θεό, το κλείνω, μου στέλνουν οι αεροπορικές προσφορές με 20 ευρώ.
Η ζωή αντιγράφει τις σχέσε…

2018-08-22 17:10

ΤΟ ΠΟΝΤΙΚΙ TOPONTIKI

Eβδομαδιαία Πολιτική- Σατιρική και Aποκαλυπτική εφημερίδα. (Από το...1979, ε;)

Κατεπείγουσα έρευνα του ΙΓΜΕ σε χωριά της δυτικής Μακεδονίας που κινδυνεύουν να τα «καταπιεί» η Γη

2018-08-22 17:10

Anna-Maria annamelbox

RT @annamelbox: ✨Nέες δημιουργίες✨! Ροζ χρυσό δαχτυλίδι με ημιπολύτιμες πέτρες και λευκά διαμάντια!
📧Online eshop:

2018-08-22 17:10

SIRIUS syrios123

RT @gioxar1: Πήγαμε σε μια ταβέρνα και παραγγείλαμε τόσα που στο τέλος απ την χαρά τους μας φέρανε για επιδόρπιο φρούτα γλυκά παγωτό και μι…

2018-08-22 17:10

Tελεία και Παύλα vre_Katerina

Κατά φαντασίαν αστεία.

Είναι ανάγκη να μας φιλάτε στα μάγουλα με γλώσσα; Γράφει κάπου παγωτό πάνω στο μάγουλό μας;

2018-08-22 17:10

Ꭰձռէε🎙 ƜӇƠ Dante3Poeta

🎙Actor de Doblaje - Escritor - Artista Marcial. 🕯Director del proyecto de doblaje @casshernsinsESP

RT @Aby_saint: Creanme cuando les digo que si de por sí este anime es hermoso, sentimental,con las voces de estos pedazos de amor y talento…

2018-08-22 17:10

Anna-Maria annamelbox

✨Nέες δημιουργίες✨! Ροζ χρυσό δαχτυλίδι με ημιπολύτιμες πέτρες και λευκά διαμάντια!
📧Online eshop:…

2018-08-22 17:10

Athens Magazine AthensMagazine

Το Athens Magazine, το επίσημο lifestyle περιοδικό της πόλης, κυκλοφορεί στα καλύτερα!

Αυτό θα πει ζωάρα! 😂

Για περισσότερα βίντεο του δείτε εδώ:

2018-08-22 17:10

Thomas Mavrofides blacktom1961

We shall not cease from exploration And the end of all our exploring Will be to arrive where we started And know the place for the first time. (T. S. Eliot)

RT @KoreanGreece: Από την αρχαιότητα οι Κορεάτες έχτισαν σπίτια σε ήσυχες και ηλιόλουστες περιοχές.Τα ποτάμια και τα χωράφια είναι στο μπρο…

2018-08-22 17:10

Κένταυρος Χείρων centaurChiron1

Απλά πράγματα: Περήφανος συντηρητικός Δεξιός | Φιλελεύθερος στα οικονομικά | Λάτρης των Ενόπλων Δυνάμεων | Αρειανός από κούνια | Απρόσβλητος από αεροψεκασμούς.

RT @madrachalos: Τι πρέπει να γίνει με την ΕΡΤ των 2200 υπαλλήλων . RT για μεγαλύτερο δείγμα

2018-08-22 17:10

ΣΟΥΡτΟΥΚΛΕΜΕΣ sourtouki

Κάτι πιο εκλεκτό...Πιο εκλεκτό...Πιο εκλεκτό είπα... Πιάσε μια γίγαντες γιαχνί.

RT @KoreanGreece: Από την αρχαιότητα οι Κορεάτες έχτισαν σπίτια σε ήσυχες και ηλιόλουστες περιοχές.Τα ποτάμια και τα χωράφια είναι στο μπρο…

2018-08-22 17:10

Don Marie Jackson donmarie2018

Double-published author and Editor-in-chief of The Astonishing Tales Digital Magazine, Homeschooled my children, reaching readers is my goal.

RT @PlatoQuote: Good actions give strength to ourselves and inspire good actions in others.

2018-08-22 17:10

⚪️A-D-I-E-M-U-S ⚫️ Sativasurreal

Uncommon Valor Was A Common Virtue || Art Culture || Minimalist || Memento Mori || In a place where less means more || NEVER GIVE UP.

RT @2018Ria: Wow and ouch .... #sculptures by Thomas Hirschhorn.
Art Gallery of South Australia.
#art #sculptor #modernart

2018-08-22 17:10

Μersini Melle 👠💄👜💖🇬🇷♏ ljV7msSopds8ohc

Married 2kids💞💖💞💖
animals nauture music💖💖
ΟΣΦΠ💖💖

RT @elekara2410: Καλημερούδια γελαστά,☕🐓🐤🐬 πολύχρωμα και πάντα 🌄🌅🌞☀️⛵ Αυγουστιάτικα!⚓🛶🕶️👙👒🏊
Να έχετε φίλοι μου μια όμορφη Τετάρτη! Την αγάπ…

2018-08-22 17:10

Κάβα Δίας Σεπόλια tsigkaki

Παραδοσιακή κάβα - Παντοπωλείο

RT @beatBukowski: Λίγο καμένο

2018-08-22 17:10

BinDNA bindna

DNA Sequence Generator

TGTAGAGATAACCAGATTGTGTTCAGCCCCGGGGACCCTGGACATGCCTTACATATACGCCAAGAGGTGAATGGTACCAATGACAGATTCCGTAACAGTCCTTTATTTGTCCACT…

2018-08-22 17:10

Christina Dim ChristinaDim31

Αρσάκειο Τοσίτσειο Εκάλης

RT @EiriniLampraki: Το παρακάτω βίντεο βλάπτει σοβαρά την εγκεφαλική ισορροπία... ακατάλληλο για δημοκράτες κ σκεπτόμενους πολίτες! Κατάλλη…

2018-08-22 17:10

BinDNA bindna

DNA Sequence Generator

CGATCGCTCGTGACGGCTATTAAGAATCAGGTGTACGCAACAGACTGTGACCTAGATCAGCCAGCCTAACGAACCGGAACTATGCTATTAGACGCCCCGAGGGGTCGGGGTGGCG…

2018-08-22 17:10

BinDNA bindna

DNA Sequence Generator

TTGGTCTATCCTTGGATGTGACTCCTAGGGGCCTGAAAGCCATATAGAAGGGCAAGGCCGCACCTATAGTTAGGACGGTTCCAACTGGTCCTTCGACCGAGTCAGCATCTGAACC…

2018-08-22 17:10

BinDNA bindna

DNA Sequence Generator

TCAGCGACGCAAAACAACCACGCGTTGCGGTGACCGCTAGCCTGGATCATCAATCCAACAGCATATTTGCCATGAAGTCATGACAAGCACCCTGAACCCCTGTCTGATCTTACTC…

2018-08-22 17:10