Tweets at around 30km

It searches the Pokestop Tweets of Twitter around 30km.


Search Results

Tania Ι.🌹 altanitsa

Και αν η ζωή σε φτάνει στα όρια το κάνει κυρίως για ένα λόγο.Να τα ξεπεράσεις!

RT @mkatsiki68: Καλημέρα φίλοι μου.
Γλυκιά και όμορφη μέρα να έχετε γεμάτη χαμόγελα!!!🌺💞🌺

2018-08-22 07:26

KikiM Kikiriklou

Να θυμάσαι οτι στο πάρτι της ζωής σου
εσύ δίνεις το ρυθμό!!!

ΟΛΥΜΠΙΑΚΟΣ λατρεία ❤

RT @marialyta13: Όμορφο βράδυ

2018-08-22 07:26

Gtsilkos gtsilkos

Η ευτυχία είναι ένα όνειρο... είναι ένας τρόπος για να ταξιδεύεις

RT @papapavl: Ντροπή στον σταθμό ALPHA να έχει
δημοσιογράφο τον ΔΗΜΟ ΒΕΡΥΚΙΟ ......
Προσβάλει τον Ελληνικο λαό και την Ορθοδοξία
Σας προσβ…

2018-08-22 07:26

όντρικοτ naiegoeimai

ήμουν μπετό.

RT @EGrettou: -Η γερμανίδα που κάθεται στη μπάρα με γουστάρει τρελά.
-Πως το κατάλαβες ρε μαλάκα;
-Της ζήτησα τον αναπτήρα της και μου το ε…

2018-08-22 07:26

Μπουκλέ Αφάνα viv0o95

Φρύγανος

RT @caftis: Mνημονια τέλος

2018-08-22 07:26

Τζέημς Σώντερς AllsoftGR

Υπ. Ευρωβουλευτής 2014, Υποψ. Βουλευτής Κορινθίας 2015 Ανεξάρτητοι Έλληνες - Χριστιανοδημοκρατικό κόμμα Greek Politician at Independent Greeks

"Strong Quake Strikes in Northeastern Venezuela" by THE NEW YORK TIMES via NYT The New York Times

2018-08-22 07:26

Culturenow.gr culturenowgr

Καθημερινή ενημέρωση για την τέχνη και τον πολιτισμό στο

Η Φανί Αρντάν παρουσιάζει την Κασσάνδρα στο ΚΠΙΣΝ

2018-08-22 07:26

an_excited*guy GuyExcited

Hey! I'm 23 years old, I love music and I'm always excited!

RT @2018Ria: Lávrion, Greece

#photo #photography by g.i.o.f
#blackandwhitephotography #Greece

2018-08-22 07:26

NEKTARIA NektariaLp

James Maslow Followed 29/10/15❤️Kendall Schmidt Followed 12/11/15 Alexa Vega Followed 24/11/15❤️Jake Miller Followed 24/3/17❤️Shawn Mendes Followed 17/5/18❤️

Look is so gorgeous and awesome talented @ShawnMendes

#MMVAs #FFSingleInMyBlood

2018-08-22 07:26

ΜΒ vaswm2

RT @astrogirl34: Μου λέει ο άλλος στο αεροπλάνο παρακαλώ είναι ελεύθερη η θέση να καθήσω; και νομίζω τελικά ότι το έλα παλουκώσου δεν ήταν…

2018-08-22 07:26

Marlene ❤ Marlenkal

Neoliberal, absolutely happy, fighting with art, dreams, myself, just an eternal child... in harmonious coexistence with @AthanDim

RT @AthanDim: @machiavelli_gr @parodynews @Sidiropoulos_gr Απογοητευτικός προς ώρας, και η πολιτική σκηνή δεν μας έχει συνηθίσει σε θετικές…

2018-08-22 07:26

sonic SkyworldSonic

I am addicted to bettering myself

RT @elinampounia: Από Λάρισα προς Αθήνα ταξιδεύει κάποιος να'χει όμορφη παρέα στο ταξίδι?? Με την εθελοντική μεταφορά βοηθάμε ένα ζωάκι να…

2018-08-22 07:26

Sourouklemes sourouklemes11

What τσαπέλες?

RT @beatBukowski: μου λέει "κάτσε να σου πω τον καφέ", κάθομαι εγώ, δοκιμάζει :"μέτριος", μου λέει είναι. δίκιο είχε και σκέψου ότι αυτά εγ…

2018-08-22 07:26

Καίτη Ντιριντάουα KaitiDiridaoua

Είμαι η κόρη με τις ελιές που λέει το δημοτικό άσμα.

@belzeboulis Ωραίο, αλλά πολύ κατσαρίδα ( ο καθένας τα κολληματα του)

2018-08-22 07:25

Vassiliki Souladaki Vsouladaki

Freelance columnist. Axia plus. International relations.
Progressive Centre-left. Pasok-Kinima Allagis

Προοδευτικό μέτωπο=αέρας κοπανιστός.
Από τον άνθρωπο που στο σημερινό διάγγελμα δεν σεβάστηκε κάποιον που δέχτηκε τ…

2018-08-22 07:25

Tania Ι.🌹 altanitsa

Και αν η ζωή σε φτάνει στα όρια το κάνει κυρίως για ένα λόγο.Να τα ξεπεράσεις!

RT @GiotaGiota6: Όμορφη μέρα με υγεία,χαρά κ δύναμη❗
🌹Να απολαμβανεται την κάθε μέρα γιατί είναι ξεχωριστή🌹

💙Καλημέρα παντού από καρδιάς❤…

2018-08-22 07:25

Tinkerbell 💋 Tinkerbell2102

Happiness is a journey... Not a destination...

RT @TaZwaMouArga: Υπάρχει μια λεπτή γραμμή ανάμεσα στο χιούμορ και την αγένεια. Μην την προσπερνάτε

2018-08-22 07:25

Cathys Corner CLeighTsoukalas

ƸӜƷ Artist /spiritual and traditional .. mum and kitten mom♥ Spiritualist. Sister page at Cathy's Chat

Sweet Dreams Sweet Kitten 🐾

2018-08-22 07:25

Tania Ι.🌹 altanitsa

Και αν η ζωή σε φτάνει στα όρια το κάνει κυρίως για ένα λόγο.Να τα ξεπεράσεις!

RT @Dasydo: ΤΟΚ ΤΟΚ! ΕΙΝΑΙ ΚΑΝΕΙΣ ΕΔΩ? ΤΟΚ ΤΟΟΟΟΟΟΚ! ΤΟΚ ΤΟΚ ΤΟΟΟΟΟΟΟΚ! ΑΝΟΙΞΤΕ ΜΟΥ ΚΑΛΕΕΕΕΕ ΞΕΧΑΣΑ ΤΑ ΚΛΕΙΔΙΑΑΑΑΣ! ΝΤΡΙΙΙΙΙΙΙΙΝ! Α, ΝΑ ΧΑΘ…

2018-08-22 07:25

Nana na253145345

Ζυγός,Ολυμπιακάρα ! Moto μου: every cloud has a silver line

@Linagreek @JosVerstappen2 Μέσα έπεσες, δεν ξερω

2018-08-22 07:25

siena InsdataInter

RT @ekathimerini: US played ‘lead role’ in resolving Greece-FYROM name dispute, says Mitchell

2018-08-22 07:25

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @vre_Katerina: Έρωτας είναι άλλο πράγμα. Δεν ξέρω καν αν υπάρχει αλλά δεν είναι αυτές οι παπαριές που λέτε.

2018-08-22 07:25

Yiannis Filippou Yiannis_Filipou

RT @akotzamanidis: Γνωστές στο χώρο τους, άγνωστες στο ευρύ κοινό οι 17 αυτές παραγωγικές και δυναμικές μεσαίες επιχειρήσεις. Εξαιρετική πρ…

2018-08-22 07:25

iReporter iReporterWorld

Η ενημέρωση,είναι η Ψυχή της Δημοκρατίας

Global and World ARt in the Practice of the University Museum μέσω του χρήστη @iReporter

2018-08-22 07:25

asimokapnismeni asimokapnismeni

Δεν μου φτανει ο νοτιας εχω και την@paspar_tou να μου βαζει λογια

Soulmate💕👭💕@kamilaPardali..

RT @l_e_n_a_A_: Τρέχουμε να προλάβουμε. .
Τρέχουμε να προσπεράσουμε. .
Τρέχουμε να ξεφύγουμε. .
Από τι;
Απ τον εαυτόν μας ;
Απ την ζωή;
Αξ…

2018-08-22 07:25

Shawn Mendes shawnmondes_

Did I scare you?

RT @NektariaLp: Legend is the best and cute person always I love you so much @ShawnMendes

#MMVAs #FFSingleInMyBlood

2018-08-22 07:25

heracles karakashangi

But nobody cares until it shit happens to them

2018-08-22 07:25

heracles karakashangi

It’s no coincidence that there are more wildfires, floods, droughts, storms. The frequency of extreme weather will…

2018-08-22 07:25

heracles karakashangi

The lack of urgency by the world governments, international agencies and the general public on the topic of climate…

2018-08-22 07:25

BinDNA bindna

DNA Sequence Generator

TTAAAGAGATCTGCACCGTTTTACGTCAATTTTATGTAGGCTATGCGAGTGGCGAATATCGAACTAAGAATGCCCCCGGCGTCATACTCGCGATCTGAAAAATCCCTCCTGCCCC…

2018-08-22 07:25

BinDNA bindna

DNA Sequence Generator

TCCGCTAGCGTATCAACCCAAGAGACAGGGCGGCCTCAGCCGATTTTAGTCTCAATATCATGAATCTAGGTAGGGCTACAATGTGCAGTGCTAGAGCCATTAATGCGCTTGGTTG…

2018-08-22 07:25

BinDNA bindna

DNA Sequence Generator

TTTCTGGTTAACCGACCCGGATGAATGTAACACTAACCAGGAATAACAGGTATCTGTGCCCGTTCGCTGAGCTAGGCGGCTCAGGTGGGTTTCCAGCCTACCTCAGTCCCCGCTC…

2018-08-22 07:25

BinDNA bindna

DNA Sequence Generator

TCAACCGGGTTGGTTGGTATCCCCGGGCGGTATAGCTGAGACTTGACAGTAACGAAGTGACCAAATCGGACTATAGATAACCTGCATGAAGCTTCGTTACATAAGCCCTGTCTGG…

2018-08-22 07:25

Σεξιστικό Γουρούνι jimdts

Είμαι ένα σεξιστικό γουρούνι 🐖

@Dora37Evia Λίγες και εκλεκτές 😂😂

2018-08-22 07:25

BinDNA bindna

DNA Sequence Generator

TGTTCGAACCAGGGTAAACGAGGATGAGAAACCCTGCCCTCTCTCAGGGCGGGAAAACGGACTCATAGAGGTTATGATGCACCCGCCAAAAATGAGACGTCCTGAGAAACGCTTT…

2018-08-22 07:25

Mrs.Muffinman Janine31488793

-#Mendesarmy 💘😭
-15
-scout girl
-English,French and Arabic (I like making friends ,unless u don't like my bf)
-I wish I was a muffin but I feel like a tomato

RT @NektariaLp: @ShawnMendes Follow everyone like this

#MMVAs #FFSingleInMyBlood

2018-08-22 07:25

Francesco Chiarello francesco120207

Sociologo dell'economia e del lavoro, Università di Bari.
Velista/leninista.

RT @yanisvaroufakis: Yesterday should be a day that our universities' media schools should use as an example of the establishment's undimin…

2018-08-22 07:25

Mrs.Muffinman Janine31488793

-#Mendesarmy 💘😭
-15
-scout girl
-English,French and Arabic (I like making friends ,unless u don't like my bf)
-I wish I was a muffin but I feel like a tomato

RT @NektariaLp: Red Carpet is so cool #VMAs @ShawnMendes

#MMVAs nominate for the best song #FFSingleInMyBlood

2018-08-22 07:25

newpost.gr newpostgr

Πολιτική, επικαιρότητα, οικονομία, κοινωνία, κόσμος: Eιδήσεις που αξίζει να γνωρίζει κανείς!

Στο κενό οι ισχυρισμοί της Άγκυρας για τους «8» - Το ΣτΕ χορήγησε άσυλο στον Τούρκο πιλότο

2018-08-22 07:25

blackangel angelosangelak2

RT @silaserafim:

2018-08-22 07:25

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @kim_D_kim_D: Ωραίος ο Ιούλιος, αν τρέχεις από νησιά σε νησιά κι όχι από δουλειά σε δουλειά

2018-08-22 07:24

Ηθικό Πλεονέκτρωμα Aeropazl

Τι πηγες και ψηφισες μαλάκα Ελληνα;

RT @parapolitika: Από βουλευτής... κομπάρσος στην υποδοχή Τσίπρα η Θεοπεφτάτου (pics)

2018-08-22 07:24

🛡Klodia🛡 Klodiahk13

I 💜 to watch wrestling ~
•Seth Rollins ❤
•Roman Reigns 💙
•Dean Ambrose 💚

@WWERomanReigns Old guys... 🤣🤣

2018-08-22 07:24

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @kim_D_kim_D: Μ υπολογίζεις σ υπολογίζω, με μηδενίζεις σε μηδενίζω
Δίκαια πράματα

2018-08-22 07:24

Uma estranha que_seja_

'Ela é simples. Marrenta difícil de lidar, de conviver, de amar... Ela teimava em ser diferente, e ela era'

RT @NektariaLp: @ShawnMendes Follow everyone like this

#MMVAs #FFSingleInMyBlood

2018-08-22 07:24

Mrs.Muffinman Janine31488793

-#Mendesarmy 💘😭
-15
-scout girl
-English,French and Arabic (I like making friends ,unless u don't like my bf)
-I wish I was a muffin but I feel like a tomato

RT @NektariaLp: Legend is the best and cute person always I love you so much @ShawnMendes

#MMVAs #FFSingleInMyBlood

2018-08-22 07:24

Tania Ι.🌹 altanitsa

Και αν η ζωή σε φτάνει στα όρια το κάνει κυρίως για ένα λόγο.Να τα ξεπεράσεις!

RT @LnysQuweYyendcE: Την καλημέρα μου καλή συνέχεια παρεακιιιιι!!!

2018-08-22 07:24

Αψυχολόγητη Ioanna_Kg

Για ένα πιτόγυρο και έναν Ολυμπιακό ζούμε.

RT @vre_Katerina: Επίσης άμα καυλώνετε ξεκαυλώστε.

2018-08-22 07:24

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @kim_D_kim_D: Αληθινός - αληθοφανής αντίθετες έννοιες, μη μπερδεύεστε

2018-08-22 07:24

Δώρα Dora37Evia

Το μεγαλύτερο ταξίδι μου το έκανα στα μάτια σου!!!😊😊😊💋💋💋Ξέχασα να αδραξω τη μέρα και είμαι να σκάσω είμαι...☘️☘️☘️

@jimdts Δεν νομίζω πως υπάρχουν πολλές τέτοιες όμως..θεωρώ ο,τι αν έχουν λίγη αξιοπρέπεια θα καταλαβουν ο,τι γίνοντ…

2018-08-22 07:24

fovela fovela_3

Ενώνουμε δυνάμεις και ελπίζουμε να μεγαλώσει η παρέα μας και όπως λέει και ο τίτλος μην ΦΟΒάσαι και ΈΛΑ να δούμε τι μπορούμε να κάνουμε.

RT @zoosos: Χάθηκε αρσενικός σκύλος στο Κορωπί Αττικής

2018-08-22 07:24

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @kim_D_kim_D: Κάποια φόλλοου αποδεικνύονται αντάξια των προσδοκιών κι άλλα για ανφόλλοου

2018-08-22 07:24

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @kim_D_kim_D: Κι αυτά τα "από ευγένεια" για τους ανθρώπους είναι παιδιά, δεν τα παρεξηγούμε

2018-08-22 07:24

zarish EA #23NOV engin_fan

RT @eleniard: #EnginAkyürek #EnginLatamVisit ❤️

2018-08-22 07:24

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @kim_D_kim_D: Το "ας χαζέψω λίγο στο τουιτερ" ισχύει και κυριολεκτικά

2018-08-22 07:24

Άρτεμις Βαρδουλάκη artwsingh

Guard kids with your life; they are your past & future

Χωρίς περαιτέρω σχόλια...

2018-08-22 07:24

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @kim_D_kim_D: Δεν μπήκαμε σε κλίκες αλλού κι αλλού, θα μπούμε εδώ μέσα;
Αν υπάρχουν δλδ, που δε νομίζω αλλά να χαμε, να λέγαμε

2018-08-22 07:24

Kontra Channel KontraChannel

Αττική: 52 & 49 UHF (DIGEA) / NOVA: 852 / OTE TV: 651 / LIVE STREAM:

Ουάρντα: «Ο μπαμπάς είναι εδώ»! (ΦΩΤΟ)

2018-08-22 07:24

Psof_O Psof_O

RT @beatBukowski: Έχει επίθετο ο άλλος Καποδίστριας λες πω θα κατάγεται από ιστορική οικογένεια και το όνομα μπορεί να το 'χε παρατσούκλι ο…

2018-08-22 07:24

Ariana _ArianaIsTheOne

teenager * music addict * eurovision fan * daydreamer

RT @Demy_Official: 27🎉 This is my mood (ok, and some bday blues)
I can’t thank you enough for all the bday wishes, love and ongoing support…

2018-08-22 07:24

αΓαπω Σε αΦου 💞💕💞 agaposepoly

.Μην Παραμυθιαζεστε Απο Καθε Μπασταρδη Ιθακη Που Θα Βρεθει Να Σας Παραμυθιασει.😎

RT @Miltos_Karatzas: Η μόνη μη φυσιολογική σεξουαλική πράξη είναι αυτή που δεν μπορείς να κάνεις. Alfred Kinsey

2018-08-22 07:24

Spyridoula Zohiou zspyridoula

RT @fays_book: Η Νατάσα Καλογρίδη φωτογραφήθηκε γυμνή και μίλησε για την σχέση της με τον Αλέξανδρο Λυκουρέζο! http…

2018-08-22 07:24

angel dnk aggelos4376

no facebook...no instagram...no snapchat..ακούω τον άνεμο της ψυχής μου...

RT @kim_D_kim_D: Όταν οι αερολογίες γίνονται φιλοσοφίες..
Τουιτερ γρ

2018-08-22 07:24

Ξανθιά Frau nektariaG

Ψηλη, ξανθια, γαλανοματα.

RT @JamesASB: Περιμένουμε τόση ώρα τον μπαοκτζη της παρέας να δει το ματς για να βγούμε καμία βόλτα. Τι κατάντια είναι αυτή

2018-08-22 07:24

korina kori_lz

💚Panathinaikos🍀
If opportunity doesn't knock, build a door!!!

@drazen_11 @AnnaTh_9 @Giannis_Vl @mariakouklakh @eniiii2 @apokamenos @andreas_zar @dimkost13 Μα έτσι δεν φαίνεται?😂😂😂

2018-08-22 07:24

Ioulia Ilvanidou jouliajoe

RT @EkdoseisPataki: Ο βραβευμένος με Πούλιτζερ συγγραφέας Τζέφρυ Ευγενίδης μιλάει στο «ΒΗΜΑgazino», λίγο πριν επισκεφτεί την Ελλάδα στις 27…

2018-08-22 07:24

ΠΟΤΕ ΞΑΝΑ ΦΑΣΙΣΤΕΡΑ mikersz

ΑΕΚΑΡΑΣ , JUST ENOUGH.

@sot7388 Επαιξε κατα διαστηματα πολυ καλα
Αν το πιστευε θα εβαζε κ αλλο γκολ.

2018-08-22 07:24

mαrs southernislc

du er ikke alene ⚜

but it's not that important sooo

2018-08-22 07:24

Θανασης Καλημερης Mr_Kalimeris

Παραταμε

@moglis__ Τ αχαραγα

2018-08-22 07:24

Filathlos.gr filathlosgr

Συνεχής ενημέρωση από το πρώτο αθλητικό blog στην Ελλάδα. Μπείτε στη σελίδα μας στο

Ουάρντα: «Ο μπαμπάς είναι εδώ»! (ΦΩΤΟ)

2018-08-22 07:24

Y U K I N E ( ー̀֊ー́ )✧ Yoongi_Yukine

BTS /A.R.M.Y / Min YoonGi is my everything.






Never Mind~

RT @RaviLeanOnMe: I'm right, right?! 🤷🏻‍♀️😂

@AceRavi #라비 #VIXX #빅스 #Ravi_The_Little_Mairman #Part_Of_Ravis_World

2018-08-22 07:24

Tania Ι.🌹 altanitsa

Και αν η ζωή σε φτάνει στα όρια το κάνει κυρίως για ένα λόγο.Να τα ξεπεράσεις!

RT @marialyta13: Όμορφο βράδυ

2018-08-22 07:24

john loffreda jo_lof

MSc Sociologist

RT @CZachariadis: @kyranakis Δεν χωρούν οι 280 χαρακτήρες του twitter να σχολιάσεις τη σημερινή χυδαιότητα του @kyranakis , αρκεί όμως αυτή…

2018-08-22 07:24

ΜΒ vaswm2

RT @AnnaAgios: Έχω τελειοποιήσει το ΔΕΝΘΑΣΟΥΔΏΣΩΤΗΝΧΑΡΆΝΑΕΚΝΕΥΡΙΣΤΏΓΑΜΊΔΙ σε ένα ειρωνικό χαμόγελο.

2018-08-22 07:24

Μάνος Χαχλιουτάκης Manos_Chachliou

RT @kmitsotakis: Η Ελλάδα δεν έχει άλλο καιρό για χάσιμο. Η ζημιά που προκαλεί η κυβέρνηση αυξάνεται καθημερινά.

2018-08-22 07:24

mato X0FLkIL0DQjzx3V

RT @kyranakis: @GiotaPantazi Επειδή ξέρω ότι ρωτάτε από ειλικρινές ενδιαφέρον

2018-08-22 07:24

Nikos Pallikarakis pallikarakis

RT @papadimoulis: Πελατειακό κράτος, γραφειοκρατία, διαφθορά, φοροδιαφυγή, ισχνό κοινωνικό κράτος, αυθαιρεσία σε βάρος του περιβάλλοντος: «…

2018-08-22 07:24

Eva N.M.. Eva77NM

Θεμα χρονου ειπες.... θα περασει!

RT @Miltos_Karatzas: Η μόνη μη φυσιολογική σεξουαλική πράξη είναι αυτή που δεν μπορείς να κάνεις. Alfred Kinsey

2018-08-22 07:24

Mixalis Koustas MikeKou7

]

RT @Chris_Vasileiou: Πέρα απ' τον όλο ενθουσιασμό, εάν ο ΠΑΟΚ μετά από Σπαρτάκ Μόσχας και Βασιλεία περάσει και την Μπενφίκα σε διπλά νοκ-άο…

2018-08-22 07:24

Μαίρη Λου η Σουβλατζού mariageorgako

Ο ανθρωπος ειναι φυσει πολιτικον ζωον (Αριστοτελης) ή σκέτο ζωον(Μαιρούλα)

RT @bmwdakiasss: Και τώρα που ο Μορφέας έχασε το δρόμο τι κάνουμε?θα πάει σερί το βράδυ και το πρωί θα μαζεύουμε ότι βρούμε μπροστά μας..

2018-08-22 07:23

@Virgincoxkay Virgincoxkay1

RT @2018Ria: Aegina, Greece ... by Aspasia L.
#blackandwhitephotography #photo #photography

2018-08-22 07:23

Costis Pretenteris CPretenteriS

Relaxing...❣️❣️❣️

#themargihotel #summer2018 @ The Margi Hotel

2018-08-22 07:23

Vape Traveller vapetraveller

¡¡ATAQUES EN COSTA RICA!! ASVAPECR New video by El Mono Vapeador on YouTube

2018-08-22 07:23

Μαίρη Λου η Σουβλατζού mariageorgako

Ο ανθρωπος ειναι φυσει πολιτικον ζωον (Αριστοτελης) ή σκέτο ζωον(Μαιρούλα)

RT @bmwdakiasss: Έχουμε καταντήσει να πίνουμε μηλοκλεφτη και strongbow για να κάνουμε κεφάλι...εκεί μας ρίξατε 😂😂😂

2018-08-22 07:23

Diana 🌹 TyshleyPortugal

#CamilaCabello #Tyshley #Haleb #PLL #DELENA #TVD #Linctavia #Bughead #Thisisus Huge Camila Cabello fan ❤

RT @NektariaLp: Legend is the best and cute person always I love you so much @ShawnMendes

#MMVAs #FFSingleInMyBlood

2018-08-22 07:23

KissMeAgain🌹 KissMeAgain99

Taylor 🇨🇦 🏳️‍🌈 Sci-fi fan #KatherynWinnick #Vikings #Gypsy #Wynonnaearp #OrphanBlack #Clexa #Carmilla

RT @Marilia_Marilou: Jeaney ...in a bottle ♥️
@CHANEL please help us give #Gypsy another Chance 🙌🏻

#Chanel #Chance #ChanceChanel #perfume…

2018-08-22 07:23

Gonzalo GoncaloMiguel35

Red Or Dead 1904

RT @manolis1983: Benfica CF vintage.

2018-08-22 07:23

Angela🙃 siriusblack84

Those who restrain desire do so because theirs is weak enough to be restrained.

@Babs873 No, but now that you mention it....

2018-08-22 07:23

MARVA vassiliou_1070

Λατρεύω την ελευθερία τη δική μου κ των άλλων, τη φύση, την πατρίδα μου, μα πιο πολύ το γιο μου!!!

RT @papadimoulis: Ακόμη και @ManfredWeber, ομογάλακτος κ φανατικός υποστηρικτής της ΝΔ κ του @kmitsotakis , αναγκάζεται να συνομολογήσει ότ…

2018-08-22 07:23

Theopi loves Ella theopii

I'm nothing more than recycled stardust and borrowed energy, born from a rock, spinning in the ether. I watch my life backwards and forwards and I feel free.

RT @ilkallonas: *Πανηγυρισμός Ζαμπά* #PAOKFC #PAOK #PlayOffs #SLBPAOK

2018-08-22 07:23

Μαυρόσκυλος mauroskylos

Άλλη...Εντελώς...Κατάσταση

@maxim_glendower Θα το δω όνειρο

2018-08-22 07:23

Wan Arfian ArfianWan

interest in human and social welfare. work for poultry business and veterinary. concern to animal walfare and agribusiness

RT @Guru_Plato: Sudah dua partai dari koalisi pendukung Jokowi mengisyaratkan akan pindah dukung Prabowo

2018-08-22 07:23

Antonis Papav antonispapav

Artist/Record Producer/Recording Studio owner/Radio program Producer

@BKegeroglou Όταν θέλαμε να την πέσουμε σε κορίτσι στα 15 μας, λέγαμε «ένας φίλος μας». Για να μην σε κράξουν που ή…

2018-08-22 07:23

❌❤️❤️Atlar eşekler ve köpekler💓💓🗨️ 💯🆓 fakirsinfakir2

demokrasi özgürlük adalet

@srkninci kadinlar spor yapmasın günah.

2018-08-22 07:23

jimroudis jimroudis

Απέχθεια για τα αρνητικά άτομα, τα τοξικά,τα μίζερα στην ψυχή και στην ζωή. ΑΠΕΧΘΕΙΑ στην πλέμπα. 🇬🇷🇨🇾🇺🇸🇨🇾🇬🇷🇺🇸
CPL
Pegasus flight center
Fort worth Texas

RT @pandou: Το ότι ο @AdonisGeorgiadi κλαίγεται στα κανάλια, επειδή ο Τσίπρας στο διάγγελμά του δε μνημόνευσε αυτόν, τον Βενιζέλο και τον Γ…

2018-08-22 07:23

Thanos Dimou AthanDim

Electronics engineer (EECS/RFEE). Neoliberal, believing in free market economy with minimum government involvement. In true love with @Marlenkal

@parodynews @Sidiropoulos_gr @machiavelli_gr Όποιος εδώ και δεκαετίες δεν έσπασε αυγά με την μία, έσπασε τα μούτρα…

2018-08-22 07:23

Μαίρη Λου η Σουβλατζού mariageorgako

Ο ανθρωπος ειναι φυσει πολιτικον ζωον (Αριστοτελης) ή σκέτο ζωον(Μαιρούλα)

RT @bmwdakiasss: Έναν καφέ να πάμε να πιούμε με ησυχία μια φορά τι καλά που θα ήταν...αυτό το σύμπαν πάντα να μας την κανει...

2018-08-22 07:23

fragiadaki toula FToula

RT @madrachalos: Ερωτώ ο αφελής ο φιλελές.

Αυτό το ζουρνά, τον αχρησιμοποίητο, θα τον κάνουμε κάτι τώρα που #μνημονια_τελος ή να τον στεί…

2018-08-22 07:23

Το ΑλέΤρι libo_libo

To enter BIOS press F9

RT @JSoulcrap: Έχω φλιπάρει δυο μήνες χωρίς ρεπό, σε λίγο θα λέω στους τουρίστες καλωσήρθατε στη μεταμνημονιακή Ελλάδα με ύφος Καλυβάτση

2018-08-22 07:23

Zeky nadya65332

2019 GANTI PRESIDEN.2019 PRABOWO SANDI

RT @Guru_Plato: Sudah dua partai dari koalisi pendukung Jokowi mengisyaratkan akan pindah dukung Prabowo

2018-08-22 07:23